Incidental Mutation 'R8072:Kcnj1'
ID620294
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32397297 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 339 (R339Q)
Ref Sequence ENSEMBL: ENSMUSP00000131625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect probably damaging
Transcript: ENSMUST00000047334
AA Change: R319Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: R319Q

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172015
AA Change: R339Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: R339Q

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213393
AA Change: R319Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32396766 missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32397182 missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32397336 missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32397261 missense probably benign
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32396981 missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32397018 missense probably damaging 1.00
R7870:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R8391:Kcnj1 UTSW 9 32396732 missense probably damaging 1.00
Z1177:Kcnj1 UTSW 9 32397359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCGGCAGAAACTCTTTCC -3'
(R):5'- ATGCTTCTGAACACAGCCAG -3'

Sequencing Primer
(F):5'- TCCCAACAGGACTTCGAGTTG -3'
(R):5'- AGCACTTAGGTCCTTGAGAGACTC -3'
Posted On2020-01-23