Incidental Mutation 'R8072:Apol6'
ID620302
Institutional Source Beutler Lab
Gene Symbol Apol6
Ensembl Gene ENSMUSG00000033576
Gene Nameapolipoprotein L 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77044729-77057106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77051103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 191 (T191S)
Ref Sequence ENSEMBL: ENSMUSP00000120866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]
Predicted Effect probably benign
Transcript: ENSMUST00000127957
AA Change: T191S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576
AA Change: T191S

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129468
Predicted Effect probably benign
Transcript: ENSMUST00000142405
SMART Domains Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149569
AA Change: T191S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576
AA Change: T191S

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152949
AA Change: T191S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576
AA Change: T191S

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166179
SMART Domains Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

DomainStartEndE-ValueType
Pfam:Globin 7 113 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229423
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Apol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Apol6 APN 15 77050716 missense probably damaging 1.00
IGL01788:Apol6 APN 15 77051016 missense possibly damaging 0.81
FR4304:Apol6 UTSW 15 77051436 frame shift probably null
FR4449:Apol6 UTSW 15 77051443 nonsense probably null
FR4548:Apol6 UTSW 15 77051445 frame shift probably null
FR4589:Apol6 UTSW 15 77051438 frame shift probably null
FR4737:Apol6 UTSW 15 77051442 frame shift probably null
R0350:Apol6 UTSW 15 77050947 nonsense probably null
R1167:Apol6 UTSW 15 77047108 nonsense probably null
R1906:Apol6 UTSW 15 77050860 missense probably damaging 0.99
R1996:Apol6 UTSW 15 77050756 missense probably benign 0.28
R2097:Apol6 UTSW 15 77047133 critical splice donor site probably null
R5611:Apol6 UTSW 15 77051040 splice site probably null
R5980:Apol6 UTSW 15 77051019 missense possibly damaging 0.66
R6191:Apol6 UTSW 15 77055898 missense probably benign 0.00
R6300:Apol6 UTSW 15 77051271 missense probably benign 0.01
R6519:Apol6 UTSW 15 77051276 nonsense probably null
R7569:Apol6 UTSW 15 77050698 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCAATAAAAGAGCCCTTGC -3'
(R):5'- CAAGCTCTGTTGGGTTTGCC -3'

Sequencing Primer
(F):5'- TTGCTCAGGTCAACAGCATCATG -3'
(R):5'- CCCAGAGAGTATATATGTCCTGGC -3'
Posted On2020-01-23