Incidental Mutation 'R8072:Vmn2r90'
ID620305
Institutional Source Beutler Lab
Gene Symbol Vmn2r90
Ensembl Gene ENSMUSG00000092120
Gene Namevomeronasal 2, receptor 90
SynonymsEG626942
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location17703747-17735156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17726880 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 473 (N473I)
Ref Sequence ENSEMBL: ENSMUSP00000126650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169805] [ENSMUST00000231659] [ENSMUST00000232078] [ENSMUST00000232113]
Predicted Effect probably damaging
Transcript: ENSMUST00000169805
AA Change: N473I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126650
Gene: ENSMUSG00000092120
AA Change: N473I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-43 PFAM
Pfam:NCD3G 514 567 3e-22 PFAM
Pfam:7tm_3 600 835 9.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231659
Predicted Effect probably benign
Transcript: ENSMUST00000232078
Predicted Effect probably benign
Transcript: ENSMUST00000232113
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Vmn2r90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vmn2r90 APN 17 17733496 missense probably benign 0.00
IGL01330:Vmn2r90 APN 17 17733280 missense probably benign 0.00
IGL01989:Vmn2r90 APN 17 17713232 nonsense probably null
IGL02080:Vmn2r90 APN 17 17712858 missense probably damaging 1.00
IGL02112:Vmn2r90 APN 17 17712203 missense probably damaging 0.98
IGL02123:Vmn2r90 APN 17 17733482 missense probably benign 0.01
IGL02749:Vmn2r90 APN 17 17726860 makesense probably null
IGL03114:Vmn2r90 APN 17 17733509 missense probably damaging 1.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0132:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0184:Vmn2r90 UTSW 17 17726877 nonsense probably null
R0379:Vmn2r90 UTSW 17 17728139 missense probably damaging 1.00
R1022:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1024:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1897:Vmn2r90 UTSW 17 17733304 missense probably damaging 1.00
R1993:Vmn2r90 UTSW 17 17713263 missense probably damaging 1.00
R2472:Vmn2r90 UTSW 17 17728146 missense probably damaging 1.00
R2508:Vmn2r90 UTSW 17 17733967 missense probably damaging 1.00
R2679:Vmn2r90 UTSW 17 17712869 missense possibly damaging 0.46
R3409:Vmn2r90 UTSW 17 17733376 missense probably benign 0.00
R4693:Vmn2r90 UTSW 17 17733694 missense possibly damaging 0.91
R4797:Vmn2r90 UTSW 17 17712305 missense probably damaging 1.00
R5258:Vmn2r90 UTSW 17 17712852 missense probably benign 0.12
R5358:Vmn2r90 UTSW 17 17704150 critical splice donor site probably null
R5445:Vmn2r90 UTSW 17 17734124 missense probably benign 0.04
R5446:Vmn2r90 UTSW 17 17712202 missense probably damaging 0.99
R5567:Vmn2r90 UTSW 17 17712074 missense probably damaging 1.00
R5680:Vmn2r90 UTSW 17 17726772 missense possibly damaging 0.93
R5686:Vmn2r90 UTSW 17 17713450 missense probably benign 0.02
R5751:Vmn2r90 UTSW 17 17733866 missense probably damaging 0.96
R6156:Vmn2r90 UTSW 17 17733344 missense probably benign 0.01
R6185:Vmn2r90 UTSW 17 17733382 missense probably damaging 1.00
R6450:Vmn2r90 UTSW 17 17733236 missense possibly damaging 0.47
R6707:Vmn2r90 UTSW 17 17728102 missense probably damaging 1.00
R6802:Vmn2r90 UTSW 17 17712089 missense probably damaging 1.00
R6913:Vmn2r90 UTSW 17 17704061 missense probably damaging 1.00
R7070:Vmn2r90 UTSW 17 17704051 missense probably damaging 0.98
R7237:Vmn2r90 UTSW 17 17703987 missense possibly damaging 0.92
R7503:Vmn2r90 UTSW 17 17713248 missense not run
R7698:Vmn2r90 UTSW 17 17733334 missense probably benign
R7943:Vmn2r90 UTSW 17 17712304 missense probably damaging 1.00
R8128:Vmn2r90 UTSW 17 17733893 missense probably damaging 1.00
R8295:Vmn2r90 UTSW 17 17728096 missense probably benign 0.03
R8345:Vmn2r90 UTSW 17 17712865 nonsense probably null
R8682:Vmn2r90 UTSW 17 17712082 missense possibly damaging 0.95
R8716:Vmn2r90 UTSW 17 17704081 missense probably damaging 0.98
Z1088:Vmn2r90 UTSW 17 17733617 missense probably damaging 1.00
Z1176:Vmn2r90 UTSW 17 17712817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGCTATTGTTTGTCTTACT -3'
(R):5'- GATTGGTACCAAATAACTATCCATGTA -3'

Sequencing Primer
(F):5'- TGAGAGGCCCCTCGGTATTAAAAAC -3'
(R):5'- GAGGCCATTGTATCCTCT -3'
Posted On2020-01-23