Incidental Mutation 'R8073:Cnst'
ID620319
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Nameconsortin, connexin sorting protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location179546370-179627478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179606437 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
Predicted Effect probably benign
Transcript: ENSMUST00000040706
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: T273A

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179624992 splice site probably benign
R0360:Cnst UTSW 1 179579535 missense probably benign 0.00
R1391:Cnst UTSW 1 179579486 missense possibly damaging 0.81
R1743:Cnst UTSW 1 179610392 missense probably benign 0.18
R1909:Cnst UTSW 1 179622791 missense probably damaging 1.00
R3856:Cnst UTSW 1 179579714 missense probably benign 0.02
R4565:Cnst UTSW 1 179604549 missense probably damaging 1.00
R5041:Cnst UTSW 1 179605028 missense probably damaging 0.99
R5072:Cnst UTSW 1 179622886 missense possibly damaging 0.61
R5087:Cnst UTSW 1 179622813 missense possibly damaging 0.82
R5294:Cnst UTSW 1 179610440 missense probably benign 0.03
R5349:Cnst UTSW 1 179622897 missense possibly damaging 0.58
R5394:Cnst UTSW 1 179601736 splice site probably benign
R6020:Cnst UTSW 1 179609875 missense probably benign
R6198:Cnst UTSW 1 179592865 missense probably damaging 1.00
R6669:Cnst UTSW 1 179605073 splice site probably null
R6767:Cnst UTSW 1 179609954 missense possibly damaging 0.92
R7007:Cnst UTSW 1 179610568 missense probably damaging 1.00
R7179:Cnst UTSW 1 179579382 start gained probably benign
R7356:Cnst UTSW 1 179606530 missense probably benign 0.01
R7730:Cnst UTSW 1 179625085 missense probably damaging 1.00
R7900:Cnst UTSW 1 179622888 missense probably damaging 1.00
R7983:Cnst UTSW 1 179622888 missense probably damaging 1.00
Z1088:Cnst UTSW 1 179579565 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACATTTGTTTGGAAGCATGC -3'
(R):5'- TTCCAACCCAGCATTTCACATG -3'

Sequencing Primer
(F):5'- CTCTTGTCCAAGCTTAAGGTAAGAGG -3'
(R):5'- GTAACACTTAAAATGCTGCAGGTGAC -3'
Posted On2020-01-23