Incidental Mutation 'R8073:Pip5kl1'
ID620321
Institutional Source Beutler Lab
Gene Symbol Pip5kl1
Ensembl Gene ENSMUSG00000046854
Gene Namephosphatidylinositol-4-phosphate 5-kinase-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32574797-32583782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32583428 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 359 (R359Q)
Ref Sequence ENSEMBL: ENSMUSP00000051282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000102818] [ENSMUST00000179989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055304
AA Change: R359Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854
AA Change: R359Q

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102818
SMART Domains Protein: ENSMUSP00000099882
Gene: ENSMUSG00000079442

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 48 296 4.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179989
SMART Domains Protein: ENSMUSP00000136093
Gene: ENSMUSG00000079442

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 46 296 1.7e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIP5KL1 is a phosphoinositide kinase-like protein that lacks intrinsic lipid kinase activity but associates with type I PIPKs (see PIP5K1A; MIM 603275) and may play a role in localization of PIPK activity (Chang et al., 2004 [PubMed 14701839]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Pip5kl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Pip5kl1 APN 2 32583347 missense probably benign 0.12
IGL03074:Pip5kl1 APN 2 32580341 missense probably damaging 0.97
IGL03115:Pip5kl1 APN 2 32580021 missense probably damaging 1.00
IGL03235:Pip5kl1 APN 2 32578154 missense probably damaging 0.99
PIT4280001:Pip5kl1 UTSW 2 32583458 missense probably benign 0.06
R0149:Pip5kl1 UTSW 2 32578954 missense possibly damaging 0.70
R0416:Pip5kl1 UTSW 2 32583424 nonsense probably null
R1500:Pip5kl1 UTSW 2 32576679 missense probably benign 0.38
R1887:Pip5kl1 UTSW 2 32578505 missense probably damaging 1.00
R2897:Pip5kl1 UTSW 2 32583347 missense probably benign 0.12
R3824:Pip5kl1 UTSW 2 32583271 unclassified probably null
R3937:Pip5kl1 UTSW 2 32579112 missense probably damaging 1.00
R5378:Pip5kl1 UTSW 2 32579094 missense probably benign 0.02
R7257:Pip5kl1 UTSW 2 32580431 critical splice donor site probably null
R7414:Pip5kl1 UTSW 2 32578235 missense possibly damaging 0.69
R7735:Pip5kl1 UTSW 2 32579089 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCCCTAAAGTACCTAGCTCATTTG -3'
(R):5'- AGCTGCAGAATAGTTGCCGG -3'

Sequencing Primer
(F):5'- GGAGGCGACAGCTTTATCCTATTC -3'
(R):5'- CAGAATAGTTGCCGGCGCATTG -3'
Posted On2020-01-23