Mutagenetix > Incidental Mutations

Incidental Mutation 'R8073:Ago1'

620329

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.703) question?

Stock #

R8073 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126443226 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 533 (V533I)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

Predicted Effect

probably benign
Transcript: ENSMUST00000097888
AA Change: V533I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: V533I

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

probably benign
Transcript: ENSMUST00000176315
AA Change: V229I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: V229I

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap3	A	T	6: 126,865,773	T452S	probably damaging	Het
Angpt1	C	T	15: 42,438,303	M436I	probably benign	Het
B3galt4	T	C	17: 33,950,823	K147R	probably damaging	Het
Birc6	C	A	17: 74,603,085	T1491K	probably damaging	Het
Boll	T	C	1: 55,355,722		probably benign	Het
C6	T	C	15: 4,735,193	F124L	probably benign	Het
Camta1	T	C	4: 151,078,824	Y436C	probably damaging	Het
Celsr1	T	C	15: 85,939,155	N1684S	probably benign	Het
Cflar	T	C	1: 58,752,822	L428P		Het
Clk4	T	C	11: 51,277,889	I363T	probably benign	Het
Cnst	A	G	1: 179,606,437	T273A	probably benign	Het
Col5a1	C	T	2: 27,962,129	A546V	possibly damaging	Het
Col6a6	T	A	9: 105,781,947	N600Y	probably benign	Het
Cxadr	A	G	16: 78,333,413	N156S	probably benign	Het
Diaph1	C	T	18: 37,891,797	G537E	unknown	Het
Dmxl1	T	A	18: 49,878,433	V1219D	probably damaging	Het
Dnajb12	T	A	10: 59,890,179	Y95*	probably null	Het
Dnajc5g	A	G	5: 31,111,685	T137A	probably benign	Het
Dpy19l3	G	A	7: 35,729,748	T89M	probably damaging	Het
Dusp19	C	A	2: 80,617,484	T34N	probably benign	Het
Eln	CTCCAGCTCCGAT	C	5: 134,729,149		probably benign	Het
Enpp1	A	G	10: 24,679,244	V68A	possibly damaging	Het
Epha7	T	A	4: 28,821,022	D62E	probably damaging	Het
Frmd4b	A	T	6: 97,306,713	V445E	probably benign	Het
Gp9	A	C	6: 87,779,354	D117A	probably benign	Het
Haao	T	C	17: 83,835,220	E152G	possibly damaging	Het
Ighd	A	G	12: 113,416,169	S52P	probably benign	Het
Ikzf3	T	C	11: 98,467,429	K361E	probably benign	Het
Lgi2	T	A	5: 52,546,671	E206V	probably benign	Het
Mfsd11	T	A	11: 116,863,923	V220E	probably benign	Het
Moxd1	G	T	10: 24,252,950	G200C	probably damaging	Het
Mthfd1l	C	A	10: 3,973,417	Q55K	probably benign	Het
Nlrp9a	T	A	7: 26,560,835	L672M	probably damaging	Het
Npvf	A	C	6: 50,654,369	F9V	probably damaging	Het
Nup205	G	T	6: 35,202,169		probably null	Het
Nup43	T	C	10: 7,670,949	V111A	probably benign	Het
Obscn	C	T	11: 59,135,690	R229H	probably benign	Het
Olfml2a	C	A	2: 38,957,754	R442S	probably damaging	Het
Olfr12	T	A	1: 92,620,084	D59E	probably damaging	Het
Olfr1225	T	A	2: 89,170,940	I91F	probably damaging	Het
Olfr1445	T	A	19: 12,884,616	V245E	probably benign	Het
Olfr418	A	G	1: 173,270,985	D270G	probably benign	Het
Olfr698	C	A	7: 106,752,801	E196*	probably null	Het
Pcdhga7	T	C	18: 37,715,345	F135S	probably damaging	Het
Pde4a	A	T	9: 21,210,769	I654F	probably damaging	Het
Pip5kl1	G	A	2: 32,583,428	R359Q	possibly damaging	Het
Ppp2ca	T	C	11: 52,119,297	V244A	possibly damaging	Het
Qrich1	T	A	9: 108,534,428	L384H	possibly damaging	Het
Rab4a	T	C	8: 123,827,396	V62A	possibly damaging	Het
Ranbp10	A	G	8: 105,786,629	L217P	probably damaging	Het
Rhebl1	C	T	15: 98,878,524	A131T	probably benign	Het
Rnf150	A	T	8: 82,863,917		probably benign	Het
Slc32a1	G	A	2: 158,614,765	A447T	probably damaging	Het
Spag5	T	A	11: 78,301,977	M45K	probably benign	Het
Spata13	A	G	14: 60,691,256	N88D	probably damaging	Het
Spred2	C	A	11: 20,008,422	T128N	probably benign	Het
Tenm2	T	C	11: 36,139,644	E776G	possibly damaging	Het
Tet1	C	G	10: 62,813,353	E156Q	probably damaging	Het
Tmc1	T	C	19: 20,868,361	N166S	probably benign	Het
Trim43a	C	A	9: 88,582,437	Q134K	possibly damaging	Het
Tsks	A	T	7: 44,957,881	M543L	probably benign	Het
Ttc30a2	A	G	2: 75,976,653	V505A	probably damaging	Het
Ttn	T	C	2: 76,743,837	K25571E	probably damaging	Het
Vamp5	C	A	6: 72,380,453		probably benign	Het
Vmn2r79	A	T	7: 87,002,254	Q287L	probably benign	Het
Zfp326	T	A	5: 105,914,816	V517E	unknown	Het
Zfp467	A	T	6: 48,438,025	H564Q	probably damaging	Het
Zfp51	G	A	17: 21,464,032	C303Y	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTGACAGAGCAAGTAAGC -3'
(R):5'- TACCCTTCTGCTTGGAGTGC -3'

Sequencing Primer
(F):5'- AGTAAGCGTTCATACCGCTG -3'
(R):5'- TCTGCTTGGAGTGCATCTC -3'

Posted On

2020-01-23