Incidental Mutation 'R8073:Ago1'
ID 620329
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
Accession Numbers
Essential gene? Possibly essential (E-score: 0.748) question?
Stock # R8073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126443226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 533 (V533I)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: V533I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: V533I

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: V229I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: V229I

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap3 A T 6: 126,865,773 (GRCm38) T452S probably damaging Het
Angpt1 C T 15: 42,438,303 (GRCm38) M436I probably benign Het
B3galt4 T C 17: 33,950,823 (GRCm38) K147R probably damaging Het
Birc6 C A 17: 74,603,085 (GRCm38) T1491K probably damaging Het
Boll T C 1: 55,355,722 (GRCm38) probably benign Het
C6 T C 15: 4,735,193 (GRCm38) F124L probably benign Het
Camta1 T C 4: 151,078,824 (GRCm38) Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 (GRCm38) N1684S probably benign Het
Cflar T C 1: 58,752,822 (GRCm38) L428P Het
Clk4 T C 11: 51,277,889 (GRCm38) I363T probably benign Het
Cnst A G 1: 179,606,437 (GRCm38) T273A probably benign Het
Col5a1 C T 2: 27,962,129 (GRCm38) A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 (GRCm38) N600Y probably benign Het
Cxadr A G 16: 78,333,413 (GRCm38) N156S probably benign Het
Diaph1 C T 18: 37,891,797 (GRCm38) G537E unknown Het
Dmxl1 T A 18: 49,878,433 (GRCm38) V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 (GRCm38) Y95* probably null Het
Dnajc5g A G 5: 31,111,685 (GRCm38) T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 (GRCm38) T89M probably damaging Het
Dusp19 C A 2: 80,617,484 (GRCm38) T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 (GRCm38) probably benign Het
Enpp1 A G 10: 24,679,244 (GRCm38) V68A possibly damaging Het
Epha7 T A 4: 28,821,022 (GRCm38) D62E probably damaging Het
Frmd4b A T 6: 97,306,713 (GRCm38) V445E probably benign Het
Gp9 A C 6: 87,779,354 (GRCm38) D117A probably benign Het
Haao T C 17: 83,835,220 (GRCm38) E152G possibly damaging Het
Ighd A G 12: 113,416,169 (GRCm38) S52P probably benign Het
Ikzf3 T C 11: 98,467,429 (GRCm38) K361E probably benign Het
Lgi2 T A 5: 52,546,671 (GRCm38) E206V probably benign Het
Mfsd11 T A 11: 116,863,923 (GRCm38) V220E probably benign Het
Moxd1 G T 10: 24,252,950 (GRCm38) G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 (GRCm38) Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 (GRCm38) L672M probably damaging Het
Npvf A C 6: 50,654,369 (GRCm38) F9V probably damaging Het
Nup205 G T 6: 35,202,169 (GRCm38) probably null Het
Nup43 T C 10: 7,670,949 (GRCm38) V111A probably benign Het
Obscn C T 11: 59,135,690 (GRCm38) R229H probably benign Het
Olfml2a C A 2: 38,957,754 (GRCm38) R442S probably damaging Het
Olfr12 T A 1: 92,620,084 (GRCm38) D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 (GRCm38) I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 (GRCm38) V245E probably benign Het
Olfr418 A G 1: 173,270,985 (GRCm38) D270G probably benign Het
Olfr698 C A 7: 106,752,801 (GRCm38) E196* probably null Het
Pcdhga7 T C 18: 37,715,345 (GRCm38) F135S probably damaging Het
Pde4a A T 9: 21,210,769 (GRCm38) I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 (GRCm38) R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 (GRCm38) V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 (GRCm38) L384H possibly damaging Het
Rab4a T C 8: 123,827,396 (GRCm38) V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 (GRCm38) L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 (GRCm38) A131T probably benign Het
Rnf150 A T 8: 82,863,917 (GRCm38) probably benign Het
Slc32a1 G A 2: 158,614,765 (GRCm38) A447T probably damaging Het
Spag5 T A 11: 78,301,977 (GRCm38) M45K probably benign Het
Spata13 A G 14: 60,691,256 (GRCm38) N88D probably damaging Het
Spred2 C A 11: 20,008,422 (GRCm38) T128N probably benign Het
Tenm2 T C 11: 36,139,644 (GRCm38) E776G possibly damaging Het
Tet1 C G 10: 62,813,353 (GRCm38) E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 (GRCm38) N166S probably benign Het
Trim43a C A 9: 88,582,437 (GRCm38) Q134K possibly damaging Het
Tsks A T 7: 44,957,881 (GRCm38) M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 (GRCm38) V505A probably damaging Het
Ttn T C 2: 76,743,837 (GRCm38) K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 (GRCm38) probably benign Het
Vmn2r79 A T 7: 87,002,254 (GRCm38) Q287L probably benign Het
Zfp326 T A 5: 105,914,816 (GRCm38) V517E unknown Het
Zfp467 A T 6: 48,438,025 (GRCm38) H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 (GRCm38) C303Y probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,459,817 (GRCm38) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,439,531 (GRCm38) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,453,640 (GRCm38) nonsense probably null
IGL02810:Ago1 APN 4 126,443,093 (GRCm38) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,461,794 (GRCm38) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,459,189 (GRCm38) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,443,171 (GRCm38) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,460,003 (GRCm38) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,463,691 (GRCm38) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,463,706 (GRCm38) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,443,166 (GRCm38) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,439,595 (GRCm38) missense probably benign
R0557:Ago1 UTSW 4 126,460,024 (GRCm38) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,453,633 (GRCm38) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,440,401 (GRCm38) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,463,741 (GRCm38) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,439,995 (GRCm38) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,441,236 (GRCm38) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,454,394 (GRCm38) missense probably null 0.36
R2051:Ago1 UTSW 4 126,460,453 (GRCm38) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,461,788 (GRCm38) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,463,857 (GRCm38) splice site probably null
R2256:Ago1 UTSW 4 126,441,911 (GRCm38) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,453,650 (GRCm38) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,439,939 (GRCm38) nonsense probably null
R2850:Ago1 UTSW 4 126,443,075 (GRCm38) splice site probably benign
R2993:Ago1 UTSW 4 126,440,046 (GRCm38) splice site probably benign
R3746:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R3747:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R3750:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R4600:Ago1 UTSW 4 126,460,392 (GRCm38) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,448,859 (GRCm38) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,453,654 (GRCm38) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,453,604 (GRCm38) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,461,723 (GRCm38) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,441,215 (GRCm38) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,461,037 (GRCm38) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,448,794 (GRCm38) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,460,569 (GRCm38) unclassified probably benign
R6036:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,448,808 (GRCm38) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,463,835 (GRCm38) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,454,352 (GRCm38) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,460,422 (GRCm38) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,463,706 (GRCm38) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,439,505 (GRCm38) makesense probably null
R7496:Ago1 UTSW 4 126,461,752 (GRCm38) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,453,908 (GRCm38) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,443,229 (GRCm38) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,460,417 (GRCm38) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,441,936 (GRCm38) missense probably damaging 1.00
R8086:Ago1 UTSW 4 126,460,981 (GRCm38) missense probably benign
R8127:Ago1 UTSW 4 126,454,421 (GRCm38) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,460,523 (GRCm38) unclassified probably benign
R8878:Ago1 UTSW 4 126,463,723 (GRCm38) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,463,790 (GRCm38) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,443,184 (GRCm38) missense probably benign
X0025:Ago1 UTSW 4 126,443,115 (GRCm38) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,453,656 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGACAGAGCAAGTAAGC -3'
(R):5'- TACCCTTCTGCTTGGAGTGC -3'

Sequencing Primer
(F):5'- AGTAAGCGTTCATACCGCTG -3'
(R):5'- TCTGCTTGGAGTGCATCTC -3'
Posted On 2020-01-23