Incidental Mutation 'R8073:Akap3'
ID620341
Institutional Source Beutler Lab
Gene Symbol Akap3
Ensembl Gene ENSMUSG00000030344
Gene NameA kinase (PRKA) anchor protein 3
SynonymsAkap110; Sob1; Fsp95
Accession Numbers

NCBI RefSeq: NM_009650.2; MGI:1341149

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location126853098-126874308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126865773 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 452 (T452S)
Ref Sequence ENSEMBL: ENSMUSP00000093091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878]
Predicted Effect probably damaging
Transcript: ENSMUST00000095440
AA Change: T452S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344
AA Change: T452S

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202574
AA Change: T452S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344
AA Change: T452S

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202878
AA Change: T452S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344
AA Change: T452S

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Akap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Akap3 APN 6 126865731 missense probably benign 0.38
IGL01070:Akap3 APN 6 126865879 missense possibly damaging 0.93
IGL01975:Akap3 APN 6 126874000 missense probably damaging 1.00
IGL02114:Akap3 APN 6 126865996 missense probably damaging 0.99
IGL02349:Akap3 APN 6 126860263 missense probably benign 0.01
IGL03305:Akap3 APN 6 126864765 missense probably benign
IGL03412:Akap3 APN 6 126864725 missense probably benign 0.00
IGL03097:Akap3 UTSW 6 126866416 missense probably damaging 1.00
P0012:Akap3 UTSW 6 126864601 missense possibly damaging 0.87
R0358:Akap3 UTSW 6 126866812 missense probably damaging 1.00
R1123:Akap3 UTSW 6 126865966 missense probably benign 0.27
R1163:Akap3 UTSW 6 126864787 missense probably damaging 1.00
R1458:Akap3 UTSW 6 126865554 missense probably damaging 1.00
R1769:Akap3 UTSW 6 126865846 missense possibly damaging 0.67
R1967:Akap3 UTSW 6 126865098 missense probably benign 0.02
R4030:Akap3 UTSW 6 126865021 missense probably damaging 1.00
R4618:Akap3 UTSW 6 126866443 missense probably benign 0.31
R4677:Akap3 UTSW 6 126865263 missense probably damaging 0.99
R4735:Akap3 UTSW 6 126865638 missense probably damaging 1.00
R5660:Akap3 UTSW 6 126865291 missense probably damaging 1.00
R5834:Akap3 UTSW 6 126865833 missense probably benign 0.04
R5847:Akap3 UTSW 6 126865558 missense probably damaging 1.00
R6053:Akap3 UTSW 6 126866533 missense probably damaging 0.98
R7007:Akap3 UTSW 6 126866476 missense probably damaging 0.99
R7070:Akap3 UTSW 6 126874024 missense probably damaging 1.00
R7123:Akap3 UTSW 6 126866304 missense probably benign 0.05
R7173:Akap3 UTSW 6 126864766 missense probably benign
R7238:Akap3 UTSW 6 126865237 missense probably benign 0.00
R7437:Akap3 UTSW 6 126865655 missense probably damaging 1.00
R7731:Akap3 UTSW 6 126865068 missense probably benign 0.04
R7737:Akap3 UTSW 6 126874102 missense probably damaging 1.00
X0028:Akap3 UTSW 6 126865917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCTGAGAACATCCGGAG -3'
(R):5'- ATACAATCAGGTCCTTGGCC -3'

Sequencing Primer
(F):5'- CTGAGAACATCCGGAGAGCCAG -3'
(R):5'- ATTTGCAAAATTCTCTGGTGGC -3'
Posted On2020-01-23