Incidental Mutation 'R8073:Enpp1'
ID 620357
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24555142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 68 (V68A)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000039882
AA Change: V68A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370
AA Change: V68A

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: V68A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: V68A

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135846
AA Change: V68A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: V68A

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,337,019 (GRCm39) V533I probably benign Het
Akap3 A T 6: 126,842,736 (GRCm39) T452S probably damaging Het
Angpt1 C T 15: 42,301,699 (GRCm39) M436I probably benign Het
B3galt4 T C 17: 34,169,797 (GRCm39) K147R probably damaging Het
Birc6 C A 17: 74,910,080 (GRCm39) T1491K probably damaging Het
Boll T C 1: 55,394,881 (GRCm39) probably benign Het
C6 T C 15: 4,764,675 (GRCm39) F124L probably benign Het
Camta1 T C 4: 151,163,281 (GRCm39) Y436C probably damaging Het
Celsr1 T C 15: 85,823,356 (GRCm39) N1684S probably benign Het
Cflar T C 1: 58,791,981 (GRCm39) L428P Het
Clk4 T C 11: 51,168,716 (GRCm39) I363T probably benign Het
Cnst A G 1: 179,434,002 (GRCm39) T273A probably benign Het
Col5a1 C T 2: 27,852,141 (GRCm39) A546V possibly damaging Het
Col6a6 T A 9: 105,659,146 (GRCm39) N600Y probably benign Het
Cxadr A G 16: 78,130,301 (GRCm39) N156S probably benign Het
Diaph1 C T 18: 38,024,850 (GRCm39) G537E unknown Het
Dmxl1 T A 18: 50,011,500 (GRCm39) V1219D probably damaging Het
Dnajb12 T A 10: 59,726,001 (GRCm39) Y95* probably null Het
Dnajc5g A G 5: 31,269,029 (GRCm39) T137A probably benign Het
Dpy19l3 G A 7: 35,429,173 (GRCm39) T89M probably damaging Het
Dusp19 C A 2: 80,447,828 (GRCm39) T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,758,003 (GRCm39) probably benign Het
Epha7 T A 4: 28,821,022 (GRCm39) D62E probably damaging Het
Frmd4b A T 6: 97,283,674 (GRCm39) V445E probably benign Het
Gp9 A C 6: 87,756,336 (GRCm39) D117A probably benign Het
Haao T C 17: 84,142,649 (GRCm39) E152G possibly damaging Het
Ift70a2 A G 2: 75,806,997 (GRCm39) V505A probably damaging Het
Ighd A G 12: 113,379,789 (GRCm39) S52P probably benign Het
Ikzf3 T C 11: 98,358,255 (GRCm39) K361E probably benign Het
Lgi2 T A 5: 52,704,013 (GRCm39) E206V probably benign Het
Mfsd11 T A 11: 116,754,749 (GRCm39) V220E probably benign Het
Moxd1 G T 10: 24,128,848 (GRCm39) G200C probably damaging Het
Mthfd1l C A 10: 3,923,417 (GRCm39) Q55K probably benign Het
Nlrp9a T A 7: 26,260,260 (GRCm39) L672M probably damaging Het
Npvf A C 6: 50,631,349 (GRCm39) F9V probably damaging Het
Nup205 G T 6: 35,179,104 (GRCm39) probably null Het
Nup43 T C 10: 7,546,713 (GRCm39) V111A probably benign Het
Obscn C T 11: 59,026,516 (GRCm39) R229H probably benign Het
Olfml2a C A 2: 38,847,766 (GRCm39) R442S probably damaging Het
Or10j2 A G 1: 173,098,552 (GRCm39) D270G probably benign Het
Or2ag16 C A 7: 106,352,008 (GRCm39) E196* probably null Het
Or4c120 T A 2: 89,001,284 (GRCm39) I91F probably damaging Het
Or5b12b T A 19: 12,861,980 (GRCm39) V245E probably benign Het
Or9s13 T A 1: 92,547,806 (GRCm39) D59E probably damaging Het
Pcdhga7 T C 18: 37,848,398 (GRCm39) F135S probably damaging Het
Pde4a A T 9: 21,122,065 (GRCm39) I654F probably damaging Het
Pip5kl1 G A 2: 32,473,440 (GRCm39) R359Q possibly damaging Het
Ppp2ca T C 11: 52,010,124 (GRCm39) V244A possibly damaging Het
Qrich1 T A 9: 108,411,627 (GRCm39) L384H possibly damaging Het
Rab4a T C 8: 124,554,135 (GRCm39) V62A possibly damaging Het
Ranbp10 A G 8: 106,513,261 (GRCm39) L217P probably damaging Het
Rhebl1 C T 15: 98,776,405 (GRCm39) A131T probably benign Het
Rnf150 A T 8: 83,590,546 (GRCm39) probably benign Het
Slc32a1 G A 2: 158,456,685 (GRCm39) A447T probably damaging Het
Spag5 T A 11: 78,192,803 (GRCm39) M45K probably benign Het
Spata13 A G 14: 60,928,705 (GRCm39) N88D probably damaging Het
Spred2 C A 11: 19,958,422 (GRCm39) T128N probably benign Het
Tenm2 T C 11: 36,030,471 (GRCm39) E776G possibly damaging Het
Tet1 C G 10: 62,649,132 (GRCm39) E156Q probably damaging Het
Tmc1 T C 19: 20,845,725 (GRCm39) N166S probably benign Het
Trim43a C A 9: 88,464,490 (GRCm39) Q134K possibly damaging Het
Tsks A T 7: 44,607,305 (GRCm39) M543L probably benign Het
Ttn T C 2: 76,574,181 (GRCm39) K25571E probably damaging Het
Vamp5 C A 6: 72,357,436 (GRCm39) probably benign Het
Vmn2r79 A T 7: 86,651,462 (GRCm39) Q287L probably benign Het
Zfp326 T A 5: 106,062,682 (GRCm39) V517E unknown Het
Zfp467 A T 6: 48,414,959 (GRCm39) H564Q probably damaging Het
Zfp51 G A 17: 21,684,294 (GRCm39) C303Y probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGAGTATGCACAGGACTTG -3'
(R):5'- TTTATCACCATCTCCAGAACAGGAC -3'

Sequencing Primer
(F):5'- CACAGGACTTGAAGATTACAGTTGTC -3'
(R):5'- AGAACAGGACATAAATCACAAGTATG -3'
Posted On 2020-01-23