Incidental Mutation 'R8073:Dnajb12'
ID620358
Institutional Source Beutler Lab
Gene Symbol Dnajb12
Ensembl Gene ENSMUSG00000020109
Gene NameDnaJ heat shock protein family (Hsp40) member B12
SynonymsmDj10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location59879556-59899302 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 59890179 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 95 (Y95*)
Ref Sequence ENSEMBL: ENSMUSP00000116577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020309] [ENSMUST00000131810] [ENSMUST00000142819] [ENSMUST00000146590] [ENSMUST00000147914]
Predicted Effect probably null
Transcript: ENSMUST00000020309
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000020309
Gene: ENSMUSG00000020109
AA Change: Y95*

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131810
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000116244
Gene: ENSMUSG00000020109
AA Change: Y95*

DomainStartEndE-ValueType
SCOP:d1a17__ 2 40 4e-3 SMART
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142819
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000118088
Gene: ENSMUSG00000020109
AA Change: Y95*

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146590
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000122056
Gene: ENSMUSG00000020109
AA Change: Y95*

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147914
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000116577
Gene: ENSMUSG00000020109
AA Change: Y95*

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 263 369 9.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Dnajb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Dnajb12 APN 10 59892863 splice site probably null
IGL03412:Dnajb12 APN 10 59890073 missense probably benign 0.44
PIT4382001:Dnajb12 UTSW 10 59892686 missense probably damaging 1.00
R0496:Dnajb12 UTSW 10 59879801 nonsense probably null
R1692:Dnajb12 UTSW 10 59896377 missense probably damaging 1.00
R2087:Dnajb12 UTSW 10 59890845 missense possibly damaging 0.82
R2276:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
R4110:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4113:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4365:Dnajb12 UTSW 10 59879766 missense probably damaging 1.00
R4382:Dnajb12 UTSW 10 59897499 missense probably benign
R4757:Dnajb12 UTSW 10 59892770 missense probably benign
R5156:Dnajb12 UTSW 10 59892960 missense probably damaging 1.00
R5455:Dnajb12 UTSW 10 59892752 frame shift probably null
R5484:Dnajb12 UTSW 10 59892752 frame shift probably null
R5486:Dnajb12 UTSW 10 59892752 frame shift probably null
R5487:Dnajb12 UTSW 10 59892752 frame shift probably null
R5504:Dnajb12 UTSW 10 59892752 frame shift probably null
R5506:Dnajb12 UTSW 10 59892752 frame shift probably null
R5507:Dnajb12 UTSW 10 59892752 frame shift probably null
R5560:Dnajb12 UTSW 10 59892752 frame shift probably null
R5561:Dnajb12 UTSW 10 59892752 frame shift probably null
R5601:Dnajb12 UTSW 10 59892752 frame shift probably null
R5603:Dnajb12 UTSW 10 59892752 frame shift probably null
R5604:Dnajb12 UTSW 10 59892752 frame shift probably null
R6013:Dnajb12 UTSW 10 59894341 critical splice donor site probably null
R6724:Dnajb12 UTSW 10 59892780 missense possibly damaging 0.92
R6935:Dnajb12 UTSW 10 59896503 critical splice donor site probably null
R8044:Dnajb12 UTSW 10 59896350 missense possibly damaging 0.88
X0022:Dnajb12 UTSW 10 59892976 missense probably null 0.00
Z1088:Dnajb12 UTSW 10 59890054 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTGGCTTCTTTTACCTTGCAG -3'
(R):5'- TGTGTGACAAACAGAGTTGTGG -3'

Sequencing Primer
(F):5'- TACCTTGCAGCACTGATCGAG -3'
(R):5'- AAGGTCTCCAGTCTGCAGTGTC -3'
Posted On2020-01-23