Incidental Mutation 'R8073:Spred2'
ID620360
Institutional Source Beutler Lab
Gene Symbol Spred2
Ensembl Gene ENSMUSG00000045671
Gene Namesprouty-related, EVH1 domain containing 2
SynonymsSpred-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location19924375-20024026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20008422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 128 (T128N)
Ref Sequence ENSEMBL: ENSMUSP00000090987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093298] [ENSMUST00000093299] [ENSMUST00000123036]
Predicted Effect probably benign
Transcript: ENSMUST00000093298
AA Change: T128N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090987
Gene: ENSMUSG00000045671
AA Change: T128N

DomainStartEndE-ValueType
Pfam:WH1 6 119 4.7e-13 PFAM
Pfam:Sprouty 298 403 3.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093299
AA Change: T155N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090988
Gene: ENSMUSG00000045671
AA Change: T155N

DomainStartEndE-ValueType
Pfam:WH1 91 146 4.1e-10 PFAM
Pfam:Sprouty 325 430 8.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123036
AA Change: T184N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115103
Gene: ENSMUSG00000045671
AA Change: T184N

DomainStartEndE-ValueType
Pfam:WH1 120 175 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SPRED2 is a member of the Sprouty (see SPRY1; MIM 602465)/SPRED family of proteins that regulate growth factor-induced activation of the MAP kinase cascade (see MAPK1; MIM 176948) (Nonami et al., 2004 [PubMed 15465815]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are fertile and display increased hematopoietic cell formation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Spred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0512:Spred2 UTSW 11 20008485 splice site probably benign
R0944:Spred2 UTSW 11 20001104 splice site probably benign
R1467:Spred2 UTSW 11 20018109 missense probably benign 0.00
R1467:Spred2 UTSW 11 20018109 missense probably benign 0.00
R2156:Spred2 UTSW 11 20021241 missense probably damaging 1.00
R2915:Spred2 UTSW 11 19998215 missense probably damaging 1.00
R3433:Spred2 UTSW 11 19998277 nonsense probably null
R4839:Spred2 UTSW 11 19998233 missense possibly damaging 0.53
R5100:Spred2 UTSW 11 20021291 nonsense probably null
R5353:Spred2 UTSW 11 20018155 missense possibly damaging 0.82
R5529:Spred2 UTSW 11 20021301 missense probably damaging 1.00
R5709:Spred2 UTSW 11 20021415 missense probably damaging 1.00
R6978:Spred2 UTSW 11 19998254 missense possibly damaging 0.73
R7345:Spred2 UTSW 11 19924958 critical splice donor site probably null
X0025:Spred2 UTSW 11 19998234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGAGTACATGAGGCTCTG -3'
(R):5'- CCACATAACTGCAAGTATGAGCG -3'

Sequencing Primer
(F):5'- GCTACTGCCATCTTTTAAAAGGCTG -3'
(R):5'- TAACTGCAAGTATGAGCGAGGGG -3'
Posted On2020-01-23