Mutagenetix > Incidental Mutation

Incidental Mutation 'R8073:Tenm2'

620361

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R8073 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36139644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 776 (E776G)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057207
AA Change: E776G

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: E776G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102801
AA Change: E775G

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: E775G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163524
AA Change: E775G

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: E775G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	C	T	4: 126,443,226	V533I	probably benign	Het
Akap3	A	T	6: 126,865,773	T452S	probably damaging	Het
Angpt1	C	T	15: 42,438,303	M436I	probably benign	Het
B3galt4	T	C	17: 33,950,823	K147R	probably damaging	Het
Birc6	C	A	17: 74,603,085	T1491K	probably damaging	Het
Boll	T	C	1: 55,355,722		probably benign	Het
C6	T	C	15: 4,735,193	F124L	probably benign	Het
Camta1	T	C	4: 151,078,824	Y436C	probably damaging	Het
Celsr1	T	C	15: 85,939,155	N1684S	probably benign	Het
Cflar	T	C	1: 58,752,822	L428P		Het
Clk4	T	C	11: 51,277,889	I363T	probably benign	Het
Cnst	A	G	1: 179,606,437	T273A	probably benign	Het
Col5a1	C	T	2: 27,962,129	A546V	possibly damaging	Het
Col6a6	T	A	9: 105,781,947	N600Y	probably benign	Het
Cxadr	A	G	16: 78,333,413	N156S	probably benign	Het
Diaph1	C	T	18: 37,891,797	G537E	unknown	Het
Dmxl1	T	A	18: 49,878,433	V1219D	probably damaging	Het
Dnajb12	T	A	10: 59,890,179	Y95*	probably null	Het
Dnajc5g	A	G	5: 31,111,685	T137A	probably benign	Het
Dpy19l3	G	A	7: 35,729,748	T89M	probably damaging	Het
Dusp19	C	A	2: 80,617,484	T34N	probably benign	Het
Eln	CTCCAGCTCCGAT	C	5: 134,729,149		probably benign	Het
Enpp1	A	G	10: 24,679,244	V68A	possibly damaging	Het
Epha7	T	A	4: 28,821,022	D62E	probably damaging	Het
Frmd4b	A	T	6: 97,306,713	V445E	probably benign	Het
Gp9	A	C	6: 87,779,354	D117A	probably benign	Het
Haao	T	C	17: 83,835,220	E152G	possibly damaging	Het
Ighd	A	G	12: 113,416,169	S52P	probably benign	Het
Ikzf3	T	C	11: 98,467,429	K361E	probably benign	Het
Lgi2	T	A	5: 52,546,671	E206V	probably benign	Het
Mfsd11	T	A	11: 116,863,923	V220E	probably benign	Het
Moxd1	G	T	10: 24,252,950	G200C	probably damaging	Het
Mthfd1l	C	A	10: 3,973,417	Q55K	probably benign	Het
Nlrp9a	T	A	7: 26,560,835	L672M	probably damaging	Het
Npvf	A	C	6: 50,654,369	F9V	probably damaging	Het
Nup205	G	T	6: 35,202,169		probably null	Het
Nup43	T	C	10: 7,670,949	V111A	probably benign	Het
Obscn	C	T	11: 59,135,690	R229H	probably benign	Het
Olfml2a	C	A	2: 38,957,754	R442S	probably damaging	Het
Olfr12	T	A	1: 92,620,084	D59E	probably damaging	Het
Olfr1225	T	A	2: 89,170,940	I91F	probably damaging	Het
Olfr1445	T	A	19: 12,884,616	V245E	probably benign	Het
Olfr418	A	G	1: 173,270,985	D270G	probably benign	Het
Olfr698	C	A	7: 106,752,801	E196*	probably null	Het
Pcdhga7	T	C	18: 37,715,345	F135S	probably damaging	Het
Pde4a	A	T	9: 21,210,769	I654F	probably damaging	Het
Pip5kl1	G	A	2: 32,583,428	R359Q	possibly damaging	Het
Ppp2ca	T	C	11: 52,119,297	V244A	possibly damaging	Het
Qrich1	T	A	9: 108,534,428	L384H	possibly damaging	Het
Rab4a	T	C	8: 123,827,396	V62A	possibly damaging	Het
Ranbp10	A	G	8: 105,786,629	L217P	probably damaging	Het
Rhebl1	C	T	15: 98,878,524	A131T	probably benign	Het
Rnf150	A	T	8: 82,863,917		probably benign	Het
Slc32a1	G	A	2: 158,614,765	A447T	probably damaging	Het
Spag5	T	A	11: 78,301,977	M45K	probably benign	Het
Spata13	A	G	14: 60,691,256	N88D	probably damaging	Het
Spred2	C	A	11: 20,008,422	T128N	probably benign	Het
Tet1	C	G	10: 62,813,353	E156Q	probably damaging	Het
Tmc1	T	C	19: 20,868,361	N166S	probably benign	Het
Trim43a	C	A	9: 88,582,437	Q134K	possibly damaging	Het
Tsks	A	T	7: 44,957,881	M543L	probably benign	Het
Ttc30a2	A	G	2: 75,976,653	V505A	probably damaging	Het
Ttn	T	C	2: 76,743,837	K25571E	probably damaging	Het
Vamp5	C	A	6: 72,380,453		probably benign	Het
Vmn2r79	A	T	7: 87,002,254	Q287L	probably benign	Het
Zfp326	T	A	5: 105,914,816	V517E	unknown	Het
Zfp467	A	T	6: 48,438,025	H564Q	probably damaging	Het
Zfp51	G	A	17: 21,464,032	C303Y	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGTTGGAACCTTGCTTTCC -3'
(R):5'- TGAAGGACTTCACCCCACTG -3'

Sequencing Primer
(F):5'- CTGGCCCCATGGAGATTTG -3'
(R):5'- TCACCCCACTGTGGTGTTGAG -3'

Posted On

2020-01-23