Incidental Mutation 'R8073:Clk4'
ID620362
Institutional Source Beutler Lab
Gene Symbol Clk4
Ensembl Gene ENSMUSG00000020385
Gene NameCDC like kinase 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location51261730-51281766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51277889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 363 (I363T)
Ref Sequence ENSEMBL: ENSMUSP00000090820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093132] [ENSMUST00000109111] [ENSMUST00000109113] [ENSMUST00000126131] [ENSMUST00000130641] [ENSMUST00000148053]
Predicted Effect probably benign
Transcript: ENSMUST00000093132
AA Change: I363T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090820
Gene: ENSMUSG00000020385
AA Change: I363T

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
S_TKc 159 475 1.58e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109111
AA Change: I183T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104739
Gene: ENSMUSG00000020385
AA Change: I183T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109113
AA Change: I183T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104741
Gene: ENSMUSG00000020385
AA Change: I183T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126131
SMART Domains Protein: ENSMUSP00000118972
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130641
SMART Domains Protein: ENSMUSP00000123133
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
PDB:2VAG|A 149 182 2e-14 PDB
SCOP:d1howa_ 149 182 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148053
SMART Domains Protein: ENSMUSP00000120822
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Clk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Clk4 APN 11 51281172 nonsense probably null
B6819:Clk4 UTSW 11 51275766 unclassified probably benign
K7894:Clk4 UTSW 11 51275766 unclassified probably benign
R0001:Clk4 UTSW 11 51268765 splice site probably benign
R0466:Clk4 UTSW 11 51267328 missense possibly damaging 0.59
R0692:Clk4 UTSW 11 51281328 nonsense probably null
R0719:Clk4 UTSW 11 51275493 nonsense probably null
R0723:Clk4 UTSW 11 51275493 nonsense probably null
R1277:Clk4 UTSW 11 51267189 missense probably benign
R1714:Clk4 UTSW 11 51280418 missense probably damaging 1.00
R4804:Clk4 UTSW 11 51281323 missense probably damaging 1.00
R5141:Clk4 UTSW 11 51275771 missense possibly damaging 0.79
R5399:Clk4 UTSW 11 51275257 missense probably damaging 1.00
R6182:Clk4 UTSW 11 51268182 missense possibly damaging 0.66
R6274:Clk4 UTSW 11 51271921 missense possibly damaging 0.69
R6480:Clk4 UTSW 11 51270546 nonsense probably null
R6759:Clk4 UTSW 11 51275574 missense possibly damaging 0.95
R6843:Clk4 UTSW 11 51276249 critical splice donor site probably null
R7138:Clk4 UTSW 11 51277932 missense probably damaging 1.00
R7186:Clk4 UTSW 11 51268780 missense probably benign 0.00
R7235:Clk4 UTSW 11 51276185 missense probably damaging 0.98
R7687:Clk4 UTSW 11 51281398 missense probably benign 0.02
R7842:Clk4 UTSW 11 51281129 missense probably benign 0.00
R7925:Clk4 UTSW 11 51281129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTTAAAGCTGTTGGC -3'
(R):5'- TATGAACTCTACATGAGCTCTACG -3'

Sequencing Primer
(F):5'- CCCGTAATGAGATCTGATGCC -3'
(R):5'- CTCTACATGAGCTCTACGTTAAAAG -3'
Posted On2020-01-23