Incidental Mutation 'R8073:Cxadr'
ID620374
Institutional Source Beutler Lab
Gene Symbol Cxadr
Ensembl Gene ENSMUSG00000022865
Gene Namecoxsackie virus and adenovirus receptor
SynonymsMCAR, MCVADR, 2610206D03Rik, CAR
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8073 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78301489-78359774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78333413 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 156 (N156S)
Ref Sequence ENSEMBL: ENSMUSP00000023572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023572] [ENSMUST00000114229] [ENSMUST00000231353] [ENSMUST00000231356] [ENSMUST00000232148]
PDB Structure
Crystal structure of the extracellular domains of coxsackie & adenovirus receptor from mouse (mCAR) [X-RAY DIFFRACTION]
Crystal structure of the complex of JAML and Coxsackie and Adenovirus receptor, CAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023572
AA Change: N156S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023572
Gene: ENSMUSG00000022865
AA Change: N156S

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114229
AA Change: N156S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109867
Gene: ENSMUSG00000022865
AA Change: N156S

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231251
Predicted Effect probably benign
Transcript: ENSMUST00000231353
Predicted Effect probably benign
Transcript: ENSMUST00000231356
Predicted Effect probably benign
Transcript: ENSMUST00000232148
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with focal cardiomyocyte apoptosis and extensive thoracic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Tmc1 T C 19: 20,868,361 N166S probably benign Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Cxadr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Cxadr APN 16 78334227 nonsense probably null
R0309:Cxadr UTSW 16 78334948 missense probably benign 0.00
R1129:Cxadr UTSW 16 78336433 missense probably benign 0.27
R1142:Cxadr UTSW 16 78334839 missense probably benign 0.04
R1713:Cxadr UTSW 16 78334245 missense probably damaging 1.00
R6432:Cxadr UTSW 16 78325259 missense probably damaging 1.00
R6637:Cxadr UTSW 16 78333503 missense possibly damaging 0.47
R7597:Cxadr UTSW 16 78329108 missense probably damaging 1.00
R7735:Cxadr UTSW 16 78329061 missense possibly damaging 0.92
R7809:Cxadr UTSW 16 78333519 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGGTTTGACAACATATCATTCC -3'
(R):5'- CCGCTGGGTTGAAATCTCAATC -3'

Sequencing Primer
(F):5'- CCCATACTGGCTGATGAAGG -3'
(R):5'- GGTTGAAATCTCAATCAAGGACAC -3'
Posted On2020-01-23