Incidental Mutation 'R8074:Sept2'
ID620384
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Nameseptin 2
SynonymsNedd5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location93478964-93510260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93505561 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 315 (D315G)
Ref Sequence ENSEMBL: ENSMUSP00000027495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000168776] [ENSMUST00000172165] [ENSMUST00000179353]
PDB Structure
Crystal structure of Septin 2 in complex with GppNHp and Mg2+ [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027495
AA Change: D315G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276
AA Change: D315G

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000157021
Predicted Effect probably benign
Transcript: ENSMUST00000168776
AA Change: D315G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048
AA Change: D315G

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172165
AA Change: D275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048
AA Change: D275G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179353
AA Change: D315G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048
AA Change: D315G

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5443:Sept2 UTSW 1 93497452 missense possibly damaging 0.95
R5845:Sept2 UTSW 1 93499035 unclassified probably null
R5898:Sept2 UTSW 1 93479301 missense probably benign
R6122:Sept2 UTSW 1 93497376 missense probably damaging 1.00
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
R7784:Sept2 UTSW 1 93497444 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATTTCCAGTTTCATGTTTTGTCT -3'
(R):5'- GCTACTTGAGATTGAATGAGGC -3'

Sequencing Primer
(F):5'- TCAGCCTTAGGAATGAATCTGGC -3'
(R):5'- CTACTTGAGATTGAATGAGGCAATAC -3'
Posted On2020-01-23