Incidental Mutation 'R8074:Stam2'
ID620386
Institutional Source Beutler Lab
Gene Symbol Stam2
Ensembl Gene ENSMUSG00000055371
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 2
SynonymsHbp, 1200004O12Rik, 5730456G07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location52691664-52742281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52706426 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 333 (I333K)
Ref Sequence ENSEMBL: ENSMUSP00000099820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102759] [ENSMUST00000127316] [ENSMUST00000155516]
Predicted Effect probably damaging
Transcript: ENSMUST00000102759
AA Change: I333K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099820
Gene: ENSMUSG00000055371
AA Change: I333K

DomainStartEndE-ValueType
VHS 9 140 6.36e-57 SMART
UIM 165 184 3.24e-3 SMART
SH3 205 260 5.69e-21 SMART
Pfam:GAT 294 367 2.3e-8 PFAM
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127316
AA Change: I300K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121898
Gene: ENSMUSG00000055371
AA Change: I300K

DomainStartEndE-ValueType
Pfam:VHS 4 70 8.5e-20 PFAM
UIM 132 151 3.24e-3 SMART
SH3 172 227 5.69e-21 SMART
PDB:3F1I|C 258 334 4e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155516
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal lymphocyte responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Stam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Stam2 APN 2 52706406 missense possibly damaging 0.80
IGL00471:Stam2 APN 2 52720935 missense probably damaging 1.00
IGL01480:Stam2 APN 2 52716439 missense probably benign
IGL01731:Stam2 APN 2 52708150 missense probably damaging 0.99
IGL02684:Stam2 APN 2 52719935 missense probably damaging 1.00
IGL02893:Stam2 APN 2 52714902 missense probably damaging 1.00
IGL02900:Stam2 APN 2 52708197 missense probably benign
R0110:Stam2 UTSW 2 52719986 splice site probably benign
R0257:Stam2 UTSW 2 52694782 missense possibly damaging 0.90
R0539:Stam2 UTSW 2 52703256 splice site probably benign
R1432:Stam2 UTSW 2 52714809 splice site probably benign
R1699:Stam2 UTSW 2 52703175 missense possibly damaging 0.55
R1822:Stam2 UTSW 2 52716527 missense probably damaging 1.00
R1956:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R1984:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1985:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1986:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1993:Stam2 UTSW 2 52703156 nonsense probably null
R2179:Stam2 UTSW 2 52694924 missense probably benign 0.00
R2181:Stam2 UTSW 2 52703144 missense probably benign 0.00
R4617:Stam2 UTSW 2 52715704 missense probably benign 0.00
R4723:Stam2 UTSW 2 52720950 missense probably benign 0.10
R5217:Stam2 UTSW 2 52736293 intron probably benign
R5218:Stam2 UTSW 2 52736293 intron probably benign
R5219:Stam2 UTSW 2 52736293 intron probably benign
R5366:Stam2 UTSW 2 52736293 intron probably benign
R5368:Stam2 UTSW 2 52736293 intron probably benign
R5420:Stam2 UTSW 2 52736293 intron probably benign
R5447:Stam2 UTSW 2 52736293 intron probably benign
R5490:Stam2 UTSW 2 52720917 missense probably damaging 1.00
R5799:Stam2 UTSW 2 52720910 nonsense probably null
R5861:Stam2 UTSW 2 52742104 utr 5 prime probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6490:Stam2 UTSW 2 52720942 missense probably benign 0.00
R6552:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R6792:Stam2 UTSW 2 52707981 missense probably benign
R7787:Stam2 UTSW 2 52706406 missense probably benign 0.01
R8042:Stam2 UTSW 2 52706397 critical splice donor site probably null
R8050:Stam2 UTSW 2 52719773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGGGTCCACGGTTATATAC -3'
(R):5'- GATGTTGACCTTGACTCTGGTC -3'

Sequencing Primer
(F):5'- GGGTCCACGGTTATATACATATCAC -3'
(R):5'- ACCTTGACTCTGGTCTGTGATAG -3'
Posted On2020-01-23