Incidental Mutation 'R8074:Lef1'
ID620395
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Namelymphoid enhancer binding factor 1
Synonymslymphoid enhancer factor 1, Lef-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location131110471-131224356 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 131204305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
PDB Structure
LEF1 HMG DOMAIN (FROM MOUSE), COMPLEXED WITH DNA (15BP), NMR, 12 STRUCTURES [SOLUTION NMR]
Structure of beta-catenin with Lef-1 [X-RAY DIFFRACTION]
Structure of beta-catenin with phosphorylated Lef-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000029611
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066849
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098611
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106341
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 131113850 splice site probably benign
IGL00515:Lef1 APN 3 131204277 missense probably damaging 1.00
IGL00780:Lef1 APN 3 131193130 missense possibly damaging 0.69
IGL02057:Lef1 APN 3 131200402 nonsense probably null
IGL02556:Lef1 APN 3 131194793 splice site probably null
IGL02804:Lef1 APN 3 131194689 missense probably damaging 1.00
IGL03143:Lef1 APN 3 131200316 nonsense probably null
IGL03169:Lef1 APN 3 131194663 missense probably damaging 1.00
R0470:Lef1 UTSW 3 131112826 intron probably benign
R1354:Lef1 UTSW 3 131194668 missense probably damaging 1.00
R1677:Lef1 UTSW 3 131200289 splice site probably benign
R1860:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R2013:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R2015:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R3440:Lef1 UTSW 3 131184758 missense probably damaging 1.00
R3736:Lef1 UTSW 3 131191066 missense possibly damaging 0.51
R3918:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R4052:Lef1 UTSW 3 131194689 missense probably damaging 1.00
R4346:Lef1 UTSW 3 131194708 missense probably damaging 1.00
R4608:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4764:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4786:Lef1 UTSW 3 131111524 missense probably damaging 0.99
R5298:Lef1 UTSW 3 131194667 missense possibly damaging 0.80
R5394:Lef1 UTSW 3 131194659 missense probably damaging 1.00
R6827:Lef1 UTSW 3 131200404 critical splice donor site probably null
R6893:Lef1 UTSW 3 131115500 missense possibly damaging 0.77
R6974:Lef1 UTSW 3 131111574 missense probably damaging 1.00
R7541:Lef1 UTSW 3 131191099 missense probably benign 0.00
R7544:Lef1 UTSW 3 131194765 missense probably damaging 1.00
R7652:Lef1 UTSW 3 131200354 missense probably damaging 1.00
Z1176:Lef1 UTSW 3 131200323 missense probably damaging 1.00
Z1177:Lef1 UTSW 3 131193181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGCAGAGTCCGTACAG -3'
(R):5'- TCTCTACAGGCACATTCACACTG -3'

Sequencing Primer
(F):5'- CTTGCAGAGTCCGTACAGACAGG -3'
(R):5'- TCTACAGGCACATTCACACTGAAAAG -3'
Posted On2020-01-23