Incidental Mutation 'R8074:Pabpc4'
ID620400
Institutional Source Beutler Lab
Gene Symbol Pabpc4
Ensembl Gene ENSMUSG00000011257
Gene Namepoly(A) binding protein, cytoplasmic 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location123262351-123298925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123286715 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 77 (M77L)
Ref Sequence ENSEMBL: ENSMUSP00000079070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078734] [ENSMUST00000080178] [ENSMUST00000106241] [ENSMUST00000106243] [ENSMUST00000183940]
Predicted Effect probably benign
Transcript: ENSMUST00000078734
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257
AA Change: M77L

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080178
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257
AA Change: M77L

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106241
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257
AA Change: M77L

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106243
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257
AA Change: M77L

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183940
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257
AA Change: M77L

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Pabpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pabpc4 APN 4 123286704 missense probably damaging 1.00
IGL00970:Pabpc4 APN 4 123286815 missense probably damaging 1.00
IGL03093:Pabpc4 APN 4 123286709 missense probably damaging 0.96
R0383:Pabpc4 UTSW 4 123297942 missense probably damaging 1.00
R0924:Pabpc4 UTSW 4 123294665 missense possibly damaging 0.56
R1076:Pabpc4 UTSW 4 123292908 missense possibly damaging 0.74
R1381:Pabpc4 UTSW 4 123289059 missense probably damaging 1.00
R1908:Pabpc4 UTSW 4 123289068 missense possibly damaging 0.68
R1957:Pabpc4 UTSW 4 123286865 missense probably damaging 1.00
R2324:Pabpc4 UTSW 4 123297778 splice site probably benign
R2567:Pabpc4 UTSW 4 123297951 missense probably damaging 1.00
R3768:Pabpc4 UTSW 4 123294612 missense probably damaging 1.00
R4350:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4352:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4353:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R5304:Pabpc4 UTSW 4 123290307 missense probably benign 0.43
R5386:Pabpc4 UTSW 4 123294997 missense probably benign 0.15
R5622:Pabpc4 UTSW 4 123291731 critical splice acceptor site probably null
R6853:Pabpc4 UTSW 4 123294743 missense possibly damaging 0.60
R7558:Pabpc4 UTSW 4 123294620 missense possibly damaging 0.94
R7602:Pabpc4 UTSW 4 123292892 missense possibly damaging 0.59
R7631:Pabpc4 UTSW 4 123288970 missense probably damaging 0.96
R7714:Pabpc4 UTSW 4 123295309 missense probably benign
Z1176:Pabpc4 UTSW 4 123295274 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAGAGTCCCTTGAACATG -3'
(R):5'- CTGCTAACATCATTTCACCGGG -3'

Sequencing Primer
(F):5'- GAGTCCCTTGAACATGAGCTTAGTC -3'
(R):5'- GGCTTACCTTACAGGACAAGATG -3'
Posted On2020-01-23