Incidental Mutation 'R8074:Pramef17'
ID620402
Institutional Source Beutler Lab
Gene Symbol Pramef17
Ensembl Gene ENSMUSG00000078509
Gene NamePRAME family member 17
SynonymsGm13107
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8074 (G1)
Quality Score149.008
Status Not validated
Chromosome4
Chromosomal Location143991119-143994369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143991854 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 340 (F340I)
Ref Sequence ENSEMBL: ENSMUSP00000101388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105762]
Predicted Effect probably benign
Transcript: ENSMUST00000105762
AA Change: F340I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101388
Gene: ENSMUSG00000078509
AA Change: F340I

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 5e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Pramef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Pramef17 APN 4 143993324 missense probably benign 0.01
IGL01981:Pramef17 APN 4 143994354 missense probably damaging 1.00
IGL02322:Pramef17 APN 4 143992021 splice site probably benign
IGL02514:Pramef17 APN 4 143993202 missense probably benign 0.12
IGL02806:Pramef17 APN 4 143992931 splice site probably null
IGL02888:Pramef17 APN 4 143994099 missense probably benign 0.42
IGL03032:Pramef17 APN 4 143993245 missense probably damaging 1.00
R0269:Pramef17 UTSW 4 143993518 splice site probably benign
R0363:Pramef17 UTSW 4 143991651 missense probably benign 0.01
R0617:Pramef17 UTSW 4 143993518 splice site probably benign
R1456:Pramef17 UTSW 4 143993281 missense probably benign
R1475:Pramef17 UTSW 4 143994312 missense probably benign 0.00
R1724:Pramef17 UTSW 4 143993432 missense probably benign 0.00
R2158:Pramef17 UTSW 4 143994315 missense possibly damaging 0.65
R2210:Pramef17 UTSW 4 143994219 missense probably benign
R3834:Pramef17 UTSW 4 143994226 missense probably benign 0.01
R4438:Pramef17 UTSW 4 143991622 missense probably damaging 1.00
R5152:Pramef17 UTSW 4 143994260 missense probably damaging 0.97
R5832:Pramef17 UTSW 4 143991962 missense probably damaging 0.98
R6809:Pramef17 UTSW 4 143993081 missense probably benign 0.01
R6986:Pramef17 UTSW 4 143993318 missense probably damaging 0.99
R7072:Pramef17 UTSW 4 143994128 missense probably damaging 0.97
R7144:Pramef17 UTSW 4 143991533 missense probably benign 0.43
R7268:Pramef17 UTSW 4 143993520 splice site probably null
R7737:Pramef17 UTSW 4 143991956 missense possibly damaging 0.89
R8048:Pramef17 UTSW 4 143991607 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTACAGTTCCATGGTCAGC -3'
(R):5'- TTGACCCCAACCATGTGATC -3'

Sequencing Primer
(F):5'- AGTTCCATGGTCAGCTGGCTC -3'
(R):5'- GTGATCTCTCCCTAGGTACCTGGAG -3'
Posted On2020-01-23