Incidental Mutation 'R8074:Grk4'
ID620403
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene NameG protein-coupled receptor kinase 4
SynonymsGprk2l, A830025H08Rik
Accession Numbers

Genbank: NM_019497.2, NM_001080743.1

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34660379-34755305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34676138 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000001112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112] [ENSMUST00000074651]
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: E96G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: E96G

DomainStartEndE-ValueType
RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000074651
AA Change: E96G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074223
Gene: ENSMUSG00000052783
AA Change: E96G

DomainStartEndE-ValueType
RGS 51 163 1.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148588
SMART Domains Protein: ENSMUSP00000122826
Gene: ENSMUSG00000052783

DomainStartEndE-ValueType
PDB:3NYO|B 2 80 2e-27 PDB
SCOP:d1dk8a_ 32 79 3e-5 SMART
Blast:RGS 44 81 3e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34716290 missense probably damaging 0.99
IGL00574:Grk4 APN 5 34694818 missense probably benign 0.00
IGL02127:Grk4 APN 5 34710186 missense probably benign 0.00
IGL02191:Grk4 APN 5 34755189 missense probably benign 0.27
IGL02227:Grk4 APN 5 34694782 missense probably benign 0.06
IGL03152:Grk4 APN 5 34745357 missense probably damaging 1.00
IGL03214:Grk4 APN 5 34752209 missense probably benign
F5426:Grk4 UTSW 5 34745159 splice site probably benign
R0110:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0469:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0671:Grk4 UTSW 5 34748267 missense probably benign 0.04
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1584:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1605:Grk4 UTSW 5 34674557 missense probably damaging 0.98
R1607:Grk4 UTSW 5 34731538 missense probably benign 0.01
R1903:Grk4 UTSW 5 34676187 splice site probably null
R2352:Grk4 UTSW 5 34669176 missense probably benign 0.04
R4561:Grk4 UTSW 5 34694813 missense probably benign 0.00
R4580:Grk4 UTSW 5 34660981 missense probably damaging 1.00
R4807:Grk4 UTSW 5 34752208 missense probably benign
R5412:Grk4 UTSW 5 34745268 missense probably benign 0.00
R5905:Grk4 UTSW 5 34711730 missense probably damaging 1.00
R6360:Grk4 UTSW 5 34674537 missense probably damaging 1.00
R6604:Grk4 UTSW 5 34719864 missense probably damaging 1.00
R6865:Grk4 UTSW 5 34731550 missense probably damaging 1.00
R7265:Grk4 UTSW 5 34716264 missense probably damaging 0.96
R7394:Grk4 UTSW 5 34751618 missense probably benign
R7718:Grk4 UTSW 5 34694816 missense probably benign
R7821:Grk4 UTSW 5 34710209 missense probably damaging 1.00
X0064:Grk4 UTSW 5 34719884 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCCAGTATTGTTCTTACATTCTCGGAG -3'
(R):5'- CTTATGTTCTGCTTCAGGAAACAG -3'

Sequencing Primer
(F):5'- AGAACTGCTCTCTGGTTC -3'
(R):5'- CTGCTTCAGGAAACAGAATTAAATTC -3'
Posted On2020-01-23