Incidental Mutation 'R8074:Ubn2'
ID620406
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Nameubinuclein 2
SynonymsD130059P03Rik, 6030408G03Rik, 2900060J04Rik
Accession Numbers

Genbank: NM_177185; MGI: 2444236

Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38433950-38524825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38440540 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 171 (M171K)
Ref Sequence ENSEMBL: ENSMUSP00000036188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
Predicted Effect probably benign
Transcript: ENSMUST00000039127
AA Change: M171K

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: M171K

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160583
AA Change: M171K

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: M171K

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162593
AA Change: M3K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538
AA Change: M3K

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38482605 missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38491899 missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38463714 missense probably benign
IGL03382:Ubn2 APN 6 38440447 unclassified probably benign
A4554:Ubn2 UTSW 6 38484110 missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38434600 critical splice donor site probably null
R0034:Ubn2 UTSW 6 38491406 synonymous silent
R0121:Ubn2 UTSW 6 38452858 splice site probably benign
R0267:Ubn2 UTSW 6 38482618 critical splice donor site probably null
R1864:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38491291 missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38470141 splice site probably null
R2184:Ubn2 UTSW 6 38484094 missense probably damaging 1.00
R2212:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R2442:Ubn2 UTSW 6 38491005 missense probably benign 0.00
R3413:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R4725:Ubn2 UTSW 6 38522305 utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38479140 missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38487153 splice site probably null
R4812:Ubn2 UTSW 6 38463726 missense probably benign
R4934:Ubn2 UTSW 6 38490498 missense probably benign 0.04
R5580:Ubn2 UTSW 6 38483252 missense probably damaging 0.99
R5598:Ubn2 UTSW 6 38490388 missense probably benign 0.00
R5672:Ubn2 UTSW 6 38461527 missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38461477 nonsense probably null
R5817:Ubn2 UTSW 6 38479153 missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38491488 missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38463982 missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6174:Ubn2 UTSW 6 38461536 missense probably damaging 1.00
R6338:Ubn2 UTSW 6 38490714 missense probably benign 0.00
R6653:Ubn2 UTSW 6 38434462 missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38452876 nonsense probably null
R7685:Ubn2 UTSW 6 38491792 missense probably benign 0.02
R7727:Ubn2 UTSW 6 38463938 missense probably benign 0.08
R7777:Ubn2 UTSW 6 38490753 missense probably damaging 1.00
RF024:Ubn2 UTSW 6 38463628 missense probably damaging 1.00
X0010:Ubn2 UTSW 6 38483120 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGTCTGTTAGCTGTGTACCATC -3'
(R):5'- CAAACCTGTAAAACTGTCTGGC -3'

Sequencing Primer
(F):5'- GTTAGCTGTGTACCATCATTTAAATG -3'
(R):5'- ACTGTCTGGCTGTCAAAACC -3'
Posted On2020-01-23