Incidental Mutation 'R8074:Prkcg'
ID620409
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Nameprotein kinase C, gamma
SynonymsPrkcc, PKCgamma, Pkcc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3289179-3331099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3323521 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 501 (M501K)
Ref Sequence ENSEMBL: ENSMUSP00000097874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100301] [ENSMUST00000172109]
Predicted Effect probably damaging
Transcript: ENSMUST00000100301
AA Change: M501K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816
AA Change: M501K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172109
AA Change: M450K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816
AA Change: M450K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203081
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3319619 missense probably benign 0.27
IGL01551:Prkcg APN 7 3303826 unclassified probably benign
IGL02167:Prkcg APN 7 3322581 critical splice donor site probably null
IGL02434:Prkcg APN 7 3318890 missense probably benign
R0044:Prkcg UTSW 7 3315001 intron probably benign
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0413:Prkcg UTSW 7 3319579 missense probably benign 0.00
R0417:Prkcg UTSW 7 3304304 critical splice acceptor site probably null
R1113:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1170:Prkcg UTSW 7 3319661 missense probably damaging 0.97
R1308:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1634:Prkcg UTSW 7 3323470 missense probably damaging 1.00
R1978:Prkcg UTSW 7 3305346 missense probably damaging 1.00
R2016:Prkcg UTSW 7 3323550 missense probably damaging 0.98
R2209:Prkcg UTSW 7 3303581 unclassified probably benign
R3788:Prkcg UTSW 7 3313747 missense probably damaging 0.99
R4006:Prkcg UTSW 7 3327467 missense probably damaging 0.96
R4853:Prkcg UTSW 7 3318953 missense probably damaging 0.99
R4915:Prkcg UTSW 7 3330265 nonsense probably null
R4916:Prkcg UTSW 7 3330265 nonsense probably null
R4997:Prkcg UTSW 7 3322581 critical splice donor site probably null
R5446:Prkcg UTSW 7 3330264 missense probably benign 0.00
R5646:Prkcg UTSW 7 3329081 missense probably damaging 0.97
R5677:Prkcg UTSW 7 3323458 missense probably damaging 1.00
R6913:Prkcg UTSW 7 3313819 missense probably benign 0.02
R7355:Prkcg UTSW 7 3323509 missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3319553 missense probably benign 0.27
R7544:Prkcg UTSW 7 3310565 missense probably benign 0.00
R7649:Prkcg UTSW 7 3329964 missense probably benign 0.09
R7742:Prkcg UTSW 7 3329943 missense possibly damaging 0.84
R8009:Prkcg UTSW 7 3314192 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTAGTGCTCAGATTACAAAATCC -3'
(R):5'- ATACGCTATTCATCCTCAAGTCCTG -3'

Sequencing Primer
(F):5'- AGTAGACTAGGTCTGCCTACC -3'
(R):5'- CATTTGAGGTAGGCAGATCTAGCCC -3'
Posted On2020-01-23