Incidental Mutation 'R8074:Clec18a'
ID620417
Institutional Source Beutler Lab
Gene Symbol Clec18a
Ensembl Gene ENSMUSG00000033633
Gene NameC-type lectin domain family 18, member A
SynonymsMrcl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111058920-111092426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111071598 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 489 (D489A)
Ref Sequence ENSEMBL: ENSMUSP00000046546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039597] [ENSMUST00000186384] [ENSMUST00000188466] [ENSMUST00000190222] [ENSMUST00000190778] [ENSMUST00000191030] [ENSMUST00000191469]
Predicted Effect probably damaging
Transcript: ENSMUST00000039597
AA Change: D489A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046546
Gene: ENSMUSG00000033633
AA Change: D489A

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186384
Predicted Effect probably damaging
Transcript: ENSMUST00000188466
AA Change: D428A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141073
Gene: ENSMUSG00000033633
AA Change: D428A

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
CLECT 324 460 2.3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190222
SMART Domains Protein: ENSMUSP00000139634
Gene: ENSMUSG00000033633

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
Pfam:Lectin_C 343 418 1.7e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190778
SMART Domains Protein: ENSMUSP00000139789
Gene: ENSMUSG00000033633

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191030
AA Change: D459A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139569
Gene: ENSMUSG00000033633
AA Change: D459A

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
SCP 100 248 5.76e-19 SMART
EGF 282 319 5.32e-1 SMART
EGF_like 321 350 4.83e1 SMART
CLECT 355 491 4.65e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191469
AA Change: D489A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139515
Gene: ENSMUSG00000033633
AA Change: D489A

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Clec18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Clec18a APN 8 111071613 missense probably damaging 1.00
LCD18:Clec18a UTSW 8 111076136 splice site probably benign
R1251:Clec18a UTSW 8 111081638 missense possibly damaging 0.46
R1528:Clec18a UTSW 8 111078866 missense probably benign 0.00
R1994:Clec18a UTSW 8 111081602 missense possibly damaging 0.90
R2283:Clec18a UTSW 8 111075508 missense probably benign 0.33
R4458:Clec18a UTSW 8 111075470 missense probably damaging 1.00
R4790:Clec18a UTSW 8 111072085 missense probably damaging 1.00
R5249:Clec18a UTSW 8 111073736 missense probably damaging 1.00
R5848:Clec18a UTSW 8 111075461 missense probably benign 0.24
R5862:Clec18a UTSW 8 111081558 missense possibly damaging 0.46
R6052:Clec18a UTSW 8 111078816 nonsense probably null
R6361:Clec18a UTSW 8 111081029 intron probably benign
R6786:Clec18a UTSW 8 111080940 missense probably benign 0.00
R7220:Clec18a UTSW 8 111081572 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTACATGGACGGAGACTTCTC -3'
(R):5'- CAACTGGGCCATCAAAAGGC -3'

Sequencing Primer
(F):5'- GGTGTCTCCCTGACCTGTG -3'
(R):5'- CTGGGCCATCAAAAGGCATTAG -3'
Posted On2020-01-23