Incidental Mutation 'R8074:Hsd17b2'
ID620418
Institutional Source Beutler Lab
Gene Symbol Hsd17b2
Ensembl Gene ENSMUSG00000031844
Gene Namehydroxysteroid (17-beta) dehydrogenase 2
Synonyms17 HSD type 2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location117701904-117759027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117758701 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000034304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034304
AA Change: V301A

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034304
Gene: ENSMUSG00000031844
AA Change: V301A

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Pfam:adh_short 84 279 1.3e-48 PFAM
Pfam:KR 85 263 3.6e-7 PFAM
Pfam:DUF1776 85 361 3.2e-13 PFAM
Pfam:adh_short_C2 89 288 1.5e-13 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality starting at E11.5 and placenta defects. The few mutants that survive to birth exhibit enlarged brain ventricles, cerebral cortex abnormalities and a single kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Hsd17b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Hsd17b2 APN 8 117758671 missense probably damaging 0.98
IGL00907:Hsd17b2 APN 8 117734694 missense probably benign 0.00
R0664:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
R1506:Hsd17b2 UTSW 8 117702265 critical splice donor site probably null
R1627:Hsd17b2 UTSW 8 117702170 missense possibly damaging 0.53
R1822:Hsd17b2 UTSW 8 117758749 missense possibly damaging 0.47
R1930:Hsd17b2 UTSW 8 117758904 missense possibly damaging 0.56
R2055:Hsd17b2 UTSW 8 117702174 missense possibly damaging 0.96
R3159:Hsd17b2 UTSW 8 117758752 missense probably damaging 1.00
R6536:Hsd17b2 UTSW 8 117702182 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACCCATCTTTCCTAGCAG -3'
(R):5'- CTGTCCTTAAAGCTCTCGGC -3'

Sequencing Primer
(F):5'- TTCCTGGTTCAGGATCTC -3'
(R):5'- TATAACATAGTCAAGTAAGCTGGTGG -3'
Posted On2020-01-23