Incidental Mutation 'R8074:Htr1b'
ID620421
Institutional Source Beutler Lab
Gene Symbol Htr1b
Ensembl Gene ENSMUSG00000049511
Gene Name5-hydroxytryptamine (serotonin) receptor 1B
Synonyms5-HT1B receptor, 5-HT<1B> receptor, 5HT1B receptor
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location81628291-81633828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81631529 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 342 (F342L)
Ref Sequence ENSEMBL: ENSMUSP00000139389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051005] [ENSMUST00000183482]
Predicted Effect probably benign
Transcript: ENSMUST00000051005
AA Change: F342L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000050898
Gene: ENSMUSG00000049511
AA Change: F342L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 6e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183482
AA Change: F342L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139389
Gene: ENSMUSG00000049511
AA Change: F342L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 5.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an increase in body weight, aggression, drinking behavior, and osteoblast proliferation and bone mass, and show altered spatial learning and operant conditional behavior as well as reduced anxiety-related response and startle reflex, and small testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Htr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Htr1b APN 9 81631636 missense probably damaging 1.00
IGL03144:Htr1b APN 9 81631945 missense probably damaging 0.96
IGL03350:Htr1b APN 9 81632122 missense probably damaging 1.00
R0395:Htr1b UTSW 9 81631651 missense probably benign 0.09
R0697:Htr1b UTSW 9 81631463 missense possibly damaging 0.77
R1569:Htr1b UTSW 9 81632287 missense probably benign 0.01
R3411:Htr1b UTSW 9 81632041 missense probably benign 0.00
R3821:Htr1b UTSW 9 81632434 missense probably benign 0.02
R4359:Htr1b UTSW 9 81632351 missense probably benign 0.12
R4487:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4489:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4715:Htr1b UTSW 9 81631510 missense possibly damaging 0.95
R5502:Htr1b UTSW 9 81631801 missense possibly damaging 0.82
R6393:Htr1b UTSW 9 81631757 missense probably benign 0.11
R6616:Htr1b UTSW 9 81632434 missense probably benign
R6900:Htr1b UTSW 9 81631570 missense probably damaging 1.00
R7038:Htr1b UTSW 9 81632243 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGACCTACCTGTGAAAAGACCC -3'
(R):5'- GGTCTCCTGTGTACGTGAAC -3'

Sequencing Primer
(F):5'- TTGGTCCCCAAAGGTCGCTTAG -3'
(R):5'- CCTGTGTACGTGAACCAAGTC -3'
Posted On2020-01-23