Incidental Mutation 'R8074:Tmem200a'
ID620422
Institutional Source Beutler Lab
Gene Symbol Tmem200a
Ensembl Gene ENSMUSG00000049420
Gene Nametransmembrane protein 200A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location25912331-26079052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25992952 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 473 (E473G)
Ref Sequence ENSEMBL: ENSMUSP00000064080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066049] [ENSMUST00000218232] [ENSMUST00000219338] [ENSMUST00000219651] [ENSMUST00000219872]
Predicted Effect probably damaging
Transcript: ENSMUST00000066049
AA Change: E473G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064080
Gene: ENSMUSG00000049420
AA Change: E473G

DomainStartEndE-ValueType
Pfam:DUF2371 16 161 8.9e-62 PFAM
low complexity region 262 279 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218232
AA Change: E473G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219338
Predicted Effect probably benign
Transcript: ENSMUST00000219651
Predicted Effect probably benign
Transcript: ENSMUST00000219872
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Tmem200a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tmem200a APN 10 25994143 missense probably damaging 0.98
IGL02323:Tmem200a APN 10 25993430 missense probably benign 0.12
IGL02702:Tmem200a APN 10 25993603 missense probably damaging 1.00
IGL03221:Tmem200a APN 10 25994024 missense possibly damaging 0.54
R0467:Tmem200a UTSW 10 25994104 missense probably benign 0.09
R1169:Tmem200a UTSW 10 25994348 missense probably damaging 1.00
R1543:Tmem200a UTSW 10 26078620 unclassified probably benign
R1555:Tmem200a UTSW 10 25993884 missense probably damaging 1.00
R1630:Tmem200a UTSW 10 25992914 missense probably damaging 1.00
R1693:Tmem200a UTSW 10 25993979 missense possibly damaging 0.94
R1786:Tmem200a UTSW 10 25993927 missense probably damaging 1.00
R1891:Tmem200a UTSW 10 25994072 missense probably damaging 1.00
R2113:Tmem200a UTSW 10 25993322 missense probably damaging 1.00
R2260:Tmem200a UTSW 10 25993415 missense probably benign
R3793:Tmem200a UTSW 10 25994189 missense probably damaging 1.00
R5062:Tmem200a UTSW 10 25993915 missense probably damaging 1.00
R5178:Tmem200a UTSW 10 25994379 missense probably benign 0.02
R5195:Tmem200a UTSW 10 26078956 unclassified probably benign
R5208:Tmem200a UTSW 10 25994153 missense probably benign 0.00
R6045:Tmem200a UTSW 10 25993007 missense probably damaging 1.00
R6319:Tmem200a UTSW 10 25993495 missense probably damaging 1.00
R6552:Tmem200a UTSW 10 25993483 missense probably damaging 1.00
R7797:Tmem200a UTSW 10 25993966 missense possibly damaging 0.95
R8009:Tmem200a UTSW 10 25994006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTTCTAACACGCTGAC -3'
(R):5'- CTTAGACAGAGGTCCTTCCACAC -3'

Sequencing Primer
(F):5'- CCATTTCTAACACGCTGACATTTGAG -3'
(R):5'- GAGGTCCTTCCACACTCACCG -3'
Posted On2020-01-23