Incidental Mutation 'R8074:Rnf145'
ID620429
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44557436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 373 (D373E)
Ref Sequence ENSEMBL: ENSMUSP00000019333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333] [ENSMUST00000101327]
Predicted Effect probably damaging
Transcript: ENSMUST00000019333
AA Change: D373E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: D373E

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101327
SMART Domains Protein: ENSMUSP00000098881
Gene: ENSMUSG00000019189

DomainStartEndE-ValueType
Pfam:TRC8_N 7 266 1.2e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0598:Rnf145 UTSW 11 44548943 missense probably damaging 1.00
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R0837:Rnf145 UTSW 11 44524988 missense probably benign 0.00
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R3855:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4564:Rnf145 UTSW 11 44548808 missense probably benign 0.25
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R6963:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R7035:Rnf145 UTSW 11 44561756 missense probably damaging 1.00
R7154:Rnf145 UTSW 11 44524995 missense probably damaging 1.00
R7351:Rnf145 UTSW 11 44548796 missense possibly damaging 0.91
R7639:Rnf145 UTSW 11 44531357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCACTCTGCTGATCCTG -3'
(R):5'- CTGATTAGGAAAGCCAAAGACC -3'

Sequencing Primer
(F):5'- TGATCCTGGCGGTGCAGAC -3'
(R):5'- TTCACTGAGACCGTGAATCG -3'
Posted On2020-01-23