Incidental Mutation 'R8074:Olfr23'
ID620430
Institutional Source Beutler Lab
Gene Symbol Olfr23
Ensembl Gene ENSMUSG00000069816
Gene Nameolfactory receptor 23
SynonymsMTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73936677-73942658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73940387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 47 (V47D)
Ref Sequence ENSEMBL: ENSMUSP00000150593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092917] [ENSMUST00000214210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092917
AA Change: V47D

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090596
Gene: ENSMUSG00000069816
AA Change: V47D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-6 PFAM
Pfam:7tm_1 41 290 9.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214210
AA Change: V47D

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Olfr23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr23 APN 11 73941194 missense probably benign
IGL02290:Olfr23 APN 11 73940869 missense probably benign 0.00
IGL02301:Olfr23 APN 11 73941068 missense possibly damaging 0.79
IGL02303:Olfr23 APN 11 73940450 missense possibly damaging 0.87
IGL02510:Olfr23 APN 11 73941005 missense probably damaging 1.00
IGL02558:Olfr23 APN 11 73940825 missense probably benign 0.01
IGL02712:Olfr23 APN 11 73940930 missense probably benign 0.12
IGL02795:Olfr23 APN 11 73940929 missense probably benign 0.05
IGL02800:Olfr23 APN 11 73941116 missense probably damaging 1.00
IGL03350:Olfr23 APN 11 73940838 missense probably damaging 0.99
R0277:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0323:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0333:Olfr23 UTSW 11 73940767 missense possibly damaging 0.78
R0389:Olfr23 UTSW 11 73941053 missense probably benign 0.12
R0391:Olfr23 UTSW 11 73941109 missense probably damaging 1.00
R0723:Olfr23 UTSW 11 73940270 missense probably benign 0.00
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1900:Olfr23 UTSW 11 73940660 missense possibly damaging 0.79
R2363:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4236:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4630:Olfr23 UTSW 11 73940996 missense probably damaging 1.00
R4717:Olfr23 UTSW 11 73940815 missense possibly damaging 0.86
R4801:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4802:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4964:Olfr23 UTSW 11 73941202 missense probably benign 0.04
R5119:Olfr23 UTSW 11 73940552 missense possibly damaging 0.76
R5470:Olfr23 UTSW 11 73940870 missense probably benign 0.06
R6196:Olfr23 UTSW 11 73940809 missense possibly damaging 0.86
R6551:Olfr23 UTSW 11 73940303 missense probably benign 0.11
R7695:Olfr23 UTSW 11 73940894 missense possibly damaging 0.94
X0065:Olfr23 UTSW 11 73940324 missense possibly damaging 0.59
Z1088:Olfr23 UTSW 11 73941138 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAAGCCCTTGTCTTACGTATATG -3'
(R):5'- CATAACGGTCATAGGCCATGG -3'

Sequencing Primer
(F):5'- GGAAGATAGATCATGCCTGG -3'
(R):5'- GGCAACAAGGAGTAAACTCTCAAC -3'
Posted On2020-01-23