Incidental Mutation 'R8074:Spag9'
ID620431
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94112051 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1129 (F1129Y)
Ref Sequence ENSEMBL: ENSMUSP00000042271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000153076]
Predicted Effect probably damaging
Transcript: ENSMUST00000024979
AA Change: F991Y

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: F991Y

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: F1129Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: F1129Y

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075695
AA Change: F990Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: F990Y

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092777
AA Change: F991Y

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: F991Y

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103168
AA Change: F986Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: F986Y

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153076
AA Change: F710Y

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: F710Y

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
R7179:Spag9 UTSW 11 94089432 intron probably null
R7225:Spag9 UTSW 11 94097358 missense probably damaging 0.98
R7351:Spag9 UTSW 11 94092976 missense probably benign 0.00
R7366:Spag9 UTSW 11 94108521 missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94114351 critical splice donor site probably null
R7401:Spag9 UTSW 11 94097689 missense probably benign
R7506:Spag9 UTSW 11 94108464 missense probably damaging 1.00
R7507:Spag9 UTSW 11 94068080 missense probably benign 0.00
R7513:Spag9 UTSW 11 94112083 missense probably damaging 1.00
R7655:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7664:Spag9 UTSW 11 94102160 critical splice donor site probably null
R7665:Spag9 UTSW 11 94013654 missense probably damaging 0.98
R7862:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7945:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7963:Spag9 UTSW 11 94071834 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGAACATGGTGGTGCCTAC -3'
(R):5'- TCCTTTGGTCTGAATTCTGGATAC -3'

Sequencing Primer
(F):5'- AGTTCAGAGCCATTCTAGACGTC -3'
(R):5'- ACAATTATTCCCTGCAATTCTTTGAC -3'
Posted On2020-01-23