Incidental Mutation 'R8074:Jup'
ID620432
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100386287 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 32 (T32P)
Ref Sequence ENSEMBL: ENSMUSP00000001592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect probably damaging
Transcript: ENSMUST00000001592
AA Change: T32P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: T32P

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107403
AA Change: T32P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: T32P

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2017:Jup UTSW 11 100386341 missense probably benign 0.01
R2989:Jup UTSW 11 100376841 missense possibly damaging 0.92
R3881:Jup UTSW 11 100378381 missense probably benign
R3882:Jup UTSW 11 100378381 missense probably benign
R4176:Jup UTSW 11 100372461 missense probably benign 0.03
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R6805:Jup UTSW 11 100383458 missense probably benign 0.17
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
R7203:Jup UTSW 11 100381734 missense probably damaging 1.00
R7399:Jup UTSW 11 100378351 missense possibly damaging 0.87
R7707:Jup UTSW 11 100383052 missense possibly damaging 0.90
R8017:Jup UTSW 11 100374197 missense probably benign 0.34
R8019:Jup UTSW 11 100374197 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCCTCAAGAGTGGACACTGTG -3'
(R):5'- TATAGCTGAGTTGAAACTGGGG -3'

Sequencing Primer
(F):5'- GGCAGATCTCTGTGAGTTCAAAACC -3'
(R):5'- GGTAATGGTGTCTCCCTAGCC -3'
Posted On2020-01-23