Incidental Mutation 'R8074:Gm17175'
ID620439
Institutional Source Beutler Lab
Gene Symbol Gm17175
Ensembl Gene ENSMUSG00000091142
Gene Namepredicted gene 17175
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51568892-51574063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51571623 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 95 (M95I)
Ref Sequence ENSEMBL: ENSMUSP00000127078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096170] [ENSMUST00000162998] [ENSMUST00000172117]
Predicted Effect probably benign
Transcript: ENSMUST00000096170
SMART Domains Protein: ENSMUSP00000093884
Gene: ENSMUSG00000079244

DomainStartEndE-ValueType
Pfam:Takusan 56 144 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172117
AA Change: M95I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127078
Gene: ENSMUSG00000091142
AA Change: M95I

DomainStartEndE-ValueType
Pfam:Takusan 23 103 3.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Sra1 G A 18: 36,675,011 A388V possibly damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Gm17175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm17175 APN 14 51573069 missense possibly damaging 0.77
IGL01347:Gm17175 APN 14 51570850 missense probably damaging 0.99
IGL01553:Gm17175 APN 14 51570822 missense probably benign 0.00
IGL02436:Gm17175 APN 14 51569651 utr 3 prime probably benign
IGL02485:Gm17175 APN 14 51569611 utr 3 prime probably benign
IGL03171:Gm17175 APN 14 51571608 missense probably damaging 1.00
R4120:Gm17175 UTSW 14 51573077 missense probably damaging 0.97
R4614:Gm17175 UTSW 14 51571585 missense probably benign 0.28
R6496:Gm17175 UTSW 14 51573077 missense probably benign 0.05
R6817:Gm17175 UTSW 14 51573021 missense possibly damaging 0.91
R7000:Gm17175 UTSW 14 51573961 start codon destroyed probably null
R7814:Gm17175 UTSW 14 51574035 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCATGGTGGAAACCTTTTCGATC -3'
(R):5'- CGACTGGCATATATGGGGTG -3'

Sequencing Primer
(F):5'- GGAAACCTTTTCGATCTTGAGGATAC -3'
(R):5'- TGGGGTAGTGCATAATTCAGC -3'
Posted On2020-01-23