Incidental Mutation 'R8074:Sra1'
ID620444
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Namesteroid receptor RNA activator 1
SynonymsSrap
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8074 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36666681-36679366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36675011 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 388 (A388V)
Ref Sequence ENSEMBL: ENSMUSP00000001415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000173875] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001415
AA Change: A388V

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050
AA Change: A388V

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000006209
SMART Domains Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 65 208 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036158
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173482
Predicted Effect probably benign
Transcript: ENSMUST00000173875
SMART Domains Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 72 217 1.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,494 I1380L probably benign Het
Adcy3 T C 12: 4,134,420 V32A probably benign Het
Ano3 T A 2: 110,950,232 probably benign Het
Arhgef12 G A 9: 42,971,103 R1482* probably null Het
Cd300lg T G 11: 102,041,601 L4R probably damaging Het
Cfap57 T A 4: 118,569,625 K1072M possibly damaging Het
Clasp1 G T 1: 118,462,483 M132I probably benign Het
Clec18a T G 8: 111,071,598 D489A probably damaging Het
Cngb1 A G 8: 95,252,173 S551P Het
Efna4 G A 3: 89,335,326 T87M probably benign Het
Fam229b T C 10: 39,120,259 R42G probably null Het
Gm17175 C T 14: 51,571,623 M95I probably damaging Het
Grk4 A G 5: 34,676,138 E96G probably benign Het
Helb A C 10: 120,089,416 F1019V probably benign Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Htr1b A G 9: 81,631,529 F342L probably benign Het
Idua C A 5: 108,680,575 A265E possibly damaging Het
Jup T G 11: 100,386,287 T32P probably damaging Het
Kidins220 A G 12: 25,057,716 K1632E probably benign Het
Lef1 G A 3: 131,204,305 probably null Het
Lypla2 A G 4: 135,969,801 probably null Het
Mall A G 2: 127,729,865 M1T probably null Het
Mettl25 G T 10: 105,826,080 A343E probably benign Het
Mpdz T C 4: 81,349,087 N940S probably benign Het
Nsun4 A T 4: 116,051,434 V643D possibly damaging Het
Nupr1 A T 7: 126,624,937 F70Y possibly damaging Het
Olfr1047 C G 2: 86,228,129 V281L possibly damaging Het
Olfr202 A G 16: 59,284,186 F104L probably benign Het
Olfr23 T A 11: 73,940,387 V47D possibly damaging Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr671 A T 7: 104,975,727 I90N probably damaging Het
Olfr951 A T 9: 39,393,946 I49F probably damaging Het
Pabpc4 A T 4: 123,286,715 M77L probably benign Het
Phactr3 A G 2: 178,302,796 E429G probably damaging Het
Polr3b A G 10: 84,713,659 D915G probably damaging Het
Pramef17 A T 4: 143,991,854 F340I probably benign Het
Prkcg T A 7: 3,323,521 M501K probably damaging Het
Prkch G A 12: 73,700,267 A307T possibly damaging Het
Ptprt A G 2: 161,927,661 V428A possibly damaging Het
Rnf145 C A 11: 44,557,436 D373E probably damaging Het
Scfd2 G T 5: 74,519,596 Q299K probably benign Het
Sept2 A G 1: 93,505,561 D315G probably benign Het
Sf3a1 T A 11: 4,175,435 Y408* probably null Het
Siglecf A T 7: 43,351,790 N61Y possibly damaging Het
Sis A T 3: 72,917,198 I1334K probably damaging Het
Slc38a6 A T 12: 73,344,884 T307S possibly damaging Het
Spag9 T A 11: 94,112,051 F1129Y probably damaging Het
Srpk1 T G 17: 28,622,016 K12T probably damaging Het
Stam2 A T 2: 52,706,426 I333K probably damaging Het
Tle1 GAA GA 4: 72,138,979 probably null Het
Tmem121b T C 6: 120,492,908 K283E possibly damaging Het
Tmem200a T C 10: 25,992,952 E473G probably damaging Het
Tnxb T A 17: 34,703,981 S2513T probably benign Het
Ttll8 C T 15: 88,915,375 C621Y probably damaging Het
Ubn2 T A 6: 38,440,540 M171K probably benign Het
Vmn2r19 T A 6: 123,335,945 V658D probably damaging Het
Vwa3a A T 7: 120,799,098 I941L probably benign Het
Zbtb24 A G 10: 41,451,232 D38G probably damaging Het
Zfp628 T C 7: 4,920,206 C476R probably damaging Het
Zfp831 A C 2: 174,644,735 N401T possibly damaging Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36668739 missense probably benign 0.36
IGL01390:Sra1 APN 18 36670081 missense probably damaging 1.00
IGL01645:Sra1 APN 18 36671473 missense probably damaging 1.00
IGL02478:Sra1 APN 18 36668792 missense probably benign 0.00
IGL02578:Sra1 APN 18 36670097 nonsense probably null
R0218:Sra1 UTSW 18 36676609 unclassified probably benign
R0243:Sra1 UTSW 18 36675706 nonsense probably null
R0432:Sra1 UTSW 18 36677503 missense probably benign
R0834:Sra1 UTSW 18 36668776 missense probably benign 0.00
R1886:Sra1 UTSW 18 36668777 missense probably benign
R2105:Sra1 UTSW 18 36675068 missense probably benign 0.00
R2911:Sra1 UTSW 18 36676185 missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36676441 nonsense probably null
R5034:Sra1 UTSW 18 36678995 critical splice donor site probably null
R5091:Sra1 UTSW 18 36669959 intron probably benign
R5122:Sra1 UTSW 18 36667594 missense probably benign 0.03
R5656:Sra1 UTSW 18 36678407 missense probably damaging 0.99
R5722:Sra1 UTSW 18 36674978 missense probably damaging 1.00
R5726:Sra1 UTSW 18 36670173 intron probably benign
R5729:Sra1 UTSW 18 36667443 utr 3 prime probably benign
R5937:Sra1 UTSW 18 36671599 unclassified probably null
R6145:Sra1 UTSW 18 36667575 missense probably damaging 1.00
R6161:Sra1 UTSW 18 36670283 missense probably damaging 0.99
R7423:Sra1 UTSW 18 36667483 missense probably benign 0.00
Z1176:Sra1 UTSW 18 36670009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAATGCCCTAAACTTCAAATG -3'
(R):5'- TCCTGGAAGCATTGGGTCTG -3'

Sequencing Primer
(F):5'- CCAGATTTGGTCCTGGGATTAC -3'
(R):5'- AAGCATTGGGTCTGGCTATTGC -3'
Posted On2020-01-23