Incidental Mutation 'Z1176:Dst'
ID 620475
Institutional Source Beutler Lab
Gene Symbol Dst
Ensembl Gene ENSMUSG00000026131
Gene Name dystonin
Synonyms bullous pemphigoid antigen 1, BPAG1-n, Macf2, bullous pemphigoid antigen 1, Bpag1, A830042E19Rik, 2310001O04Rik, athetoid, Bpag, BPAG1, nmf203, nmf339, ah
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.342) question?
Stock # Z1176 ()
Quality Score 211.009
Status Not validated
Chromosome 1
Chromosomal Location 33947306-34347742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34314289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 4397 (K4397E)
Ref Sequence ENSEMBL: ENSMUSP00000095393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097785] [ENSMUST00000097786] [ENSMUST00000115104] [ENSMUST00000182018] [ENSMUST00000183034] [ENSMUST00000185269] [ENSMUST00000194192]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000097785
AA Change: K6411E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131
AA Change: K6411E

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000097786
AA Change: K4397E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131
AA Change: K4397E

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115104
AA Change: K6411E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131
AA Change: K6411E

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000182018
AA Change: K643E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138426
Gene: ENSMUSG00000026131
AA Change: K643E

DomainStartEndE-ValueType
SPEC 1 95 3.1e-8 SMART
SPEC 102 208 2.6e-9 SMART
SPEC 215 317 1.3e-17 SMART
SPEC 324 427 1.8e-12 SMART
SPEC 434 536 1.6e-28 SMART
SPEC 543 645 3.3e-20 SMART
SPEC 652 754 7.6e-17 SMART
SPEC 761 864 5.6e-19 SMART
SPEC 871 972 5.9e-25 SMART
SPEC 979 1081 3.4e-17 SMART
SPEC 1091 1221 9.7e-11 SMART
EFh 1255 1283 2e-5 SMART
EFh 1291 1319 6e-5 SMART
GAS2 1330 1408 9.8e-56 SMART
low complexity region 1432 1450 N/A INTRINSIC
low complexity region 1460 1472 N/A INTRINSIC
low complexity region 1558 1581 N/A INTRINSIC
PDB:3GJO|H 1609 1638 2e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000183034
AA Change: K6698E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131
AA Change: K6698E

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000185269
AA Change: K4180E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131
AA Change: K4180E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000194192
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 3313 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,138,097 (GRCm39) K74N probably damaging Het
1700013G24Rik C A 4: 137,182,303 (GRCm39) P153T probably damaging Het
1700017N19Rik T G 10: 100,448,291 (GRCm39) M274R probably damaging Het
1700030J22Rik G T 8: 117,700,336 (GRCm39) T22K probably benign Het
1700123K08Rik G T 5: 138,561,815 (GRCm39) Q124K probably damaging Het
2610021A01Rik G C 7: 41,274,766 (GRCm39) L156F probably benign Het
2610028H24Rik C A 10: 76,288,697 (GRCm39) P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 (GRCm38) E10G probably damaging Het
3100002H09Rik T A 4: 124,504,498 (GRCm39) D18V unknown Het
3110018I06Rik C G 12: 107,455,114 (GRCm39) R67G unknown Het
3110082J24Rik G C 5: 30,310,065 (GRCm39) A98G unknown Het
4833420G17Rik C A 13: 119,614,344 (GRCm39) T484K not run Het
4921511C20Rik A G X: 126,302,465 (GRCm39) K135E probably damaging Het
4930447C04Rik G C 12: 72,963,500 (GRCm39) F18L probably benign Het
4930503B20Rik C T 3: 146,356,711 (GRCm39) D66N probably damaging Het
4930516K23Rik A T 7: 103,708,495 (GRCm39) F105I probably damaging Het
4930562C15Rik G A 16: 4,684,112 (GRCm39) V236M possibly damaging Het
4930595M18Rik C T X: 80,463,878 (GRCm39) G610R probably damaging Het
4933402D24Rik T A 1: 63,795,494 (GRCm39) K90* probably null Het
4933402J07Rik G T 8: 88,295,202 (GRCm39) M113I probably benign Het
4933427D14Rik C T 11: 72,049,826 (GRCm39) V852I probably benign Het
4933427I04Rik T C 4: 123,754,668 (GRCm39) L194P probably damaging Het
6430571L13Rik G T 9: 107,219,726 (GRCm39) G60C probably damaging Het
9430015G10Rik G C 4: 156,206,468 (GRCm39) G76A probably benign Het
A1cf A C 19: 31,895,417 (GRCm39) I167L probably benign Het
A2ml1 A G 6: 128,548,940 (GRCm39) F281L probably benign Het
A430005L14Rik CG C 4: 154,045,122 (GRCm39) probably null Het
A730049H05Rik C A 6: 92,805,047 (GRCm39) S69* probably null Het
A830018L16Rik C G 1: 11,588,849 (GRCm39) Q89E probably damaging Het
AA986860 A C 1: 130,670,728 (GRCm39) S317R probably benign Het
Aadacl2fm2 C A 3: 59,654,615 (GRCm39) Q150K probably benign Het
AAdacl4fm3 C A 4: 144,429,895 (GRCm39) G365W probably damaging Het
Aasdh C G 5: 77,039,643 (GRCm39) probably null Het
Aass T C 6: 23,078,856 (GRCm39) T719A probably damaging Het
Aatf C T 11: 84,333,411 (GRCm39) A500T probably benign Het
Abca12 A C 1: 71,323,229 (GRCm39) Y1618D probably damaging Het
Abca13 C A 11: 9,217,461 (GRCm39) P301H probably damaging Het
Abca13 G T 11: 9,244,342 (GRCm39) W2068C probably benign Het
Abca13 G T 11: 9,285,181 (GRCm39) A3272S probably damaging Het
Abca13 C A 11: 9,285,182 (GRCm39) A3272E probably damaging Het
Abca13 G T 11: 9,201,376 (GRCm39) G153C possibly damaging Het
Abca14 G T 7: 119,846,146 (GRCm39) G599V probably damaging Het
Abca15 G T 7: 119,981,728 (GRCm39) G1061W probably damaging Het
Abca15 T G 7: 119,945,249 (GRCm39) F442V probably benign Het
Abca2 G T 2: 25,334,122 (GRCm39) V1800L probably benign Het
Abca4 G T 3: 121,897,137 (GRCm39) W605C probably damaging Het
Abca4 C A 3: 121,950,092 (GRCm39) S1805R probably damaging Het
Abca7 T C 10: 79,842,393 (GRCm39) L1109P probably damaging Het
Abca7 C T 10: 79,835,266 (GRCm39) R208* probably null Het
Abca8b A T 11: 109,852,734 (GRCm39) C761S possibly damaging Het
Abca8b G A 11: 109,865,470 (GRCm39) T329I possibly damaging Het
Abca9 G A 11: 110,026,201 (GRCm39) A953V probably benign Het
Abcb10 C A 8: 124,709,402 (GRCm39) G51C possibly damaging Het
Abcb11 C A 2: 69,122,325 (GRCm39) G386V probably damaging Het
Abcb1b A G 5: 8,877,441 (GRCm39) Y667C probably benign Het
Abcb4 C A 5: 9,009,005 (GRCm39) R1221S probably damaging Het
Abcb5 C A 12: 118,882,007 (GRCm39) G574V probably damaging Het
Abcb8 A T 5: 24,605,993 (GRCm39) D226V probably damaging Het
Abcc10 C T 17: 46,635,188 (GRCm39) A272T probably benign Het
Abcc10 G A 17: 46,624,626 (GRCm39) H784Y probably damaging Het
Abcc12 T G 8: 87,277,230 (GRCm39) K389T probably damaging Het
Abcc3 C G 11: 94,252,101 (GRCm39) Q827H probably benign Het
Abcc6 C T 7: 45,629,158 (GRCm39) D1363N probably damaging Het
Abcc6 A T 7: 45,641,730 (GRCm39) probably null Het
Abcc8 T C 7: 45,756,389 (GRCm39) S1439G possibly damaging Het
Abhd12b G A 12: 70,210,225 (GRCm39) D134N probably damaging Het
Abhd13 A C 8: 10,037,413 (GRCm39) K3N probably damaging Het
Abl1 A C 2: 31,579,839 (GRCm39) K7N probably damaging Het
Ablim2 C T 5: 36,006,202 (GRCm39) P409L possibly damaging Het
Abo C G 2: 26,738,270 (GRCm39) V45L probably benign Het
Abtb2 G T 2: 103,538,517 (GRCm39) E649* probably null Het
Acaca G C 11: 84,151,546 (GRCm39) A815P probably damaging Het
Acacb G T 5: 114,387,009 (GRCm39) R2386L probably benign Het
Acan A C 7: 78,761,102 (GRCm39) H1938P probably benign Het
Acap3 C G 4: 155,989,636 (GRCm39) N693K probably damaging Het
Acmsd G T 1: 127,673,539 (GRCm39) V76F probably damaging Het
Actc1 C A 2: 113,882,478 (GRCm39) C12F probably benign Het
Actl11 T G 9: 107,808,899 (GRCm39) V1074G probably benign Het
Actl6a A C 3: 32,780,692 (GRCm39) I411L probably benign Het
Actl9 C A 17: 33,652,075 (GRCm39) P45Q possibly damaging Het
Actr10 C A 12: 71,008,803 (GRCm39) A412E probably damaging Het
Actr1b T A 1: 36,740,289 (GRCm39) H284L probably benign Het
Actrt2 G T 4: 154,751,289 (GRCm39) N282K probably benign Het
Acvr1 C A 2: 58,369,880 (GRCm39) G43V probably benign Het
Acy3 G T 19: 4,037,107 (GRCm39) R13L probably damaging Het
Adam17 T G 12: 21,411,738 (GRCm39) Q51P possibly damaging Het
Adam21 T G 12: 81,606,517 (GRCm39) N415T probably damaging Het
Adam30 A G 3: 98,069,676 (GRCm39) Y503C possibly damaging Het
Adam32 C A 8: 25,438,766 (GRCm39) E16* probably null Het
Adam6a A G 12: 113,508,941 (GRCm39) K438R possibly damaging Het
Adam7 A T 14: 68,765,150 (GRCm39) S82R probably benign Het
Adamts10 C T 17: 33,747,761 (GRCm39) R66W probably damaging Het
Adamts10 G T 17: 33,747,762 (GRCm39) R66L probably damaging Het
Adamts12 G T 15: 11,336,469 (GRCm39) C1518F not run Het
Adamts15 G C 9: 30,821,996 (GRCm39) C480W probably damaging Het
Adamts16 C T 13: 70,909,892 (GRCm39) R887K probably benign Het
Adamts18 A T 8: 114,469,800 (GRCm39) I634N possibly damaging Het
Adamts2 G T 11: 50,683,535 (GRCm39) R939L probably damaging Het
Adamts3 C T 5: 89,923,210 (GRCm39) V199I not run Het
Adamts4 C G 1: 171,086,353 (GRCm39) A715G probably benign Het
Adamts4 G A 1: 171,086,352 (GRCm39) A715T probably benign Het
Adamtsl1 C T 4: 86,260,414 (GRCm39) P883L probably damaging Het
Adamtsl1 T G 4: 86,260,930 (GRCm39) M1055R probably benign Het
Adamtsl2 C A 2: 26,971,732 (GRCm39) Q6K probably benign Het
Adcy1 G A 11: 7,100,857 (GRCm39) R802K probably damaging Het
Adcy1 G T 11: 7,100,858 (GRCm39) R802S possibly damaging Het
Adcy1 G A 11: 7,059,098 (GRCm39) D335N probably damaging Het
Adcy1 C A 11: 7,099,536 (GRCm39) T672N probably damaging Het
Adcy5 C G 16: 35,110,555 (GRCm39) F907L probably benign Het
Adcy5 G A 16: 35,111,914 (GRCm39) V924M not run Het
Adcy5 G T 16: 34,976,691 (GRCm39) G75C unknown Het
Adcy8 T C 15: 64,597,367 (GRCm39) T895A probably benign Het
Adcy9 G T 16: 4,125,096 (GRCm39) P745Q probably damaging Het
Add2 G T 6: 86,075,572 (GRCm39) K240N probably damaging Het
Adgb G T 10: 10,254,486 (GRCm39) T1159N probably benign Het
Adgrb2 G T 4: 129,911,356 (GRCm39) C1126F probably damaging Het
Adgrb3 C T 1: 25,132,995 (GRCm39) D1364N probably benign Het
Adgre1 T G 17: 57,668,729 (GRCm39) L30R possibly damaging Het
Adgrg4 C A X: 55,959,619 (GRCm39) P601H probably benign Het
Adgrg4 G T X: 55,940,062 (GRCm39) V174L probably benign Het
Adgrg5 G C 8: 95,661,779 (GRCm39) W173C Het
Adgrv1 C A 13: 81,707,753 (GRCm39) A1218S possibly damaging Het
Adh7 G A 3: 137,929,492 (GRCm39) G87D probably benign Het
Adora2a C A 10: 75,169,162 (GRCm39) Q209K probably benign Het
Adprhl1 C G 8: 13,275,613 (GRCm39) A382P probably benign Het
Adprs C G 4: 126,215,360 (GRCm39) G35A probably damaging Het
Adprs C G 4: 126,215,454 (GRCm39) A4P unknown Het
Adra1a C A 14: 66,965,077 (GRCm39) L356M probably benign Het
Adra2b C A 2: 127,205,958 (GRCm39) D158E probably benign Het
Adra2c G C 5: 35,438,248 (GRCm39) R340P probably damaging Het
Adss2 C A 1: 177,624,064 (GRCm39) probably benign Het
Adss2 C A 1: 177,604,059 (GRCm39) C182F probably damaging Het
Aff3 T A 1: 38,368,953 (GRCm39) K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,354,349 (GRCm39) probably null Het
Afg2a G T 3: 37,485,899 (GRCm39) S207I possibly damaging Het
Afg3l2 C A 18: 67,564,777 (GRCm39) L232F probably benign Het
Afmid G A 11: 117,725,792 (GRCm39) D129N probably benign Het
Agap2 G C 10: 126,916,094 (GRCm39) G202R unknown Het
Agbl1 T G 7: 76,068,433 (GRCm39) L333R Het
Agbl4 G T 4: 111,383,840 (GRCm39) G232W probably damaging Het
Agbl4 T A 4: 110,518,036 (GRCm39) L109Q probably damaging Het
Ago4 C A 4: 126,413,983 (GRCm39) probably null Het
Ahcyl T C 16: 45,974,592 (GRCm39) M262V probably benign Het
Ahnak G T 19: 8,986,220 (GRCm39) M2501I probably damaging Het
AI593442 C A 9: 52,589,245 (GRCm39) G111C probably damaging Het
AI597479 A G 1: 43,152,350 (GRCm39) H216R probably benign Het
Aipl1 G T 11: 71,921,359 (GRCm39) P179T possibly damaging Het
Ak9 G C 10: 41,224,247 (GRCm39) G524R Het
Ak9 G T 10: 41,299,019 (GRCm39) W1573C unknown Het
Akap1 G T 11: 88,727,993 (GRCm39) T663N probably benign Het
Akap13 G T 7: 75,380,300 (GRCm39) R491L probably damaging Het
Akap14 G T X: 36,426,898 (GRCm39) P279H unknown Het
Akap4 G T X: 6,944,599 (GRCm39) E831* probably null Het
Akap6 C G 12: 53,187,227 (GRCm39) T1547R possibly damaging Het
Akap8 C A 17: 32,525,523 (GRCm39) V519L probably damaging Het
Akap9 G T 5: 4,012,251 (GRCm39) G985W probably damaging Het
Akirin1 C T 4: 123,643,860 (GRCm39) G33D probably damaging Het
Akr1cl C A 1: 65,055,846 (GRCm39) G219C probably damaging Het
Alas1 C A 9: 106,120,566 (GRCm39) Q76H probably benign Het
Alas1 G A 9: 106,115,968 (GRCm39) R349C probably benign Het
Aldh1l1 GAA GA 6: 90,534,266 (GRCm39) probably null Het
Aldh1l1 G T 6: 90,560,155 (GRCm39) V601L probably benign Het
Aldh3a2 T G 11: 61,155,109 (GRCm39) K145T probably benign Het
Aldoart1 C A 4: 72,770,241 (GRCm39) R189L probably benign Het
Alg8 T G 7: 97,032,968 (GRCm39) F285V probably benign Het
Alkbh8 G C 9: 3,345,820 (GRCm39) G180A probably damaging Het
Alms1 C G 6: 85,655,400 (GRCm39) N2846K probably benign Het
Alox12b G C 11: 69,048,151 (GRCm39) V27L possibly damaging Het
Alox12b T A 11: 69,048,149 (GRCm39) I26N possibly damaging Het
Aloxe3 C A 11: 69,023,905 (GRCm39) L279M probably damaging Het
Alpi T C 1: 87,026,794 (GRCm39) N428S probably benign Het
Alpk1 T A 3: 127,467,087 (GRCm39) H1064L probably damaging Het
Alpk2 G C 18: 65,438,682 (GRCm39) L904V probably damaging Het
Alpk3 G T 7: 80,728,374 (GRCm39) L501F probably benign Het
Alpl G C 4: 137,481,321 (GRCm39) S110R probably damaging Het
Alppl2 G A 1: 87,015,388 (GRCm39) S391F probably damaging Het
Alppl2 G T 1: 87,015,426 (GRCm39) H378Q probably damaging Het
Amer3 G T 1: 34,628,094 (GRCm39) V778L probably benign Het
Ampd2 C A 3: 107,987,380 (GRCm39) G151V probably damaging Het
Amz1 G T 5: 140,729,828 (GRCm39) E121* probably null Het
Ang4 G T 14: 52,001,605 (GRCm39) C114* probably null Het
Ank3 G C 10: 69,827,045 (GRCm39) E1905Q Het
Ank3 C T 10: 69,786,840 (GRCm39) A968V possibly damaging Het
Ank3 T G 10: 69,768,304 (GRCm39) L941R possibly damaging Het
Ankar G T 1: 72,729,120 (GRCm39) L342I possibly damaging Het
Ankib1 G A 5: 3,742,763 (GRCm39) S1084L probably benign Het
Ankk1 T G 9: 49,333,211 (GRCm39) K91T probably damaging Het
Ankk1 T A 9: 49,327,943 (GRCm39) Q412L probably benign Het
Ankle2 G C 5: 110,382,365 (GRCm39) E114Q possibly damaging Het
Ankmy1 C T 1: 92,806,159 (GRCm39) G780E probably damaging Het
Ankmy2 T G 12: 36,236,858 (GRCm39) M222R probably damaging Het
Ankrd11 C T 8: 123,622,542 (GRCm39) V437M possibly damaging Het
Ankrd12 C A 17: 66,277,333 (GRCm39) probably null Het
Ankrd36 T A 11: 5,565,538 (GRCm39) F457L probably benign Het
Ankrd39 C G 1: 36,581,086 (GRCm39) A88P probably damaging Het
Ankrd45 C T 1: 160,990,853 (GRCm39) A202V possibly damaging Het
Ankrd49 C G 9: 14,692,724 (GRCm39) A147P probably damaging Het
Ankrd6 G T 4: 32,806,326 (GRCm39) S642R probably benign Het
Ankrd6 C T 4: 32,806,229 (GRCm39) E675K possibly damaging Het
Ankrd6 G C 4: 32,824,486 (GRCm39) N142K probably damaging Het
Anks3 T G 16: 4,768,578 (GRCm39) Q255P probably benign Het
Ano2 T G 6: 125,840,416 (GRCm39) Y362* probably null Het
Ano2 G T 6: 125,687,670 (GRCm39) Q58H probably benign Het
Ano4 A T 10: 88,948,807 (GRCm39) V101E probably benign Het
Ano5 T A 7: 51,224,451 (GRCm39) V469E probably damaging Het
Ano6 C A 15: 95,811,341 (GRCm39) P147Q probably damaging Het
Ano7 C A 1: 93,322,187 (GRCm39) D398E probably benign Het
Anpep G C 7: 79,477,387 (GRCm39) P727A possibly damaging Het
Anxa10 T G 8: 62,516,104 (GRCm39) probably null Het
Aoc1l2 A C 6: 48,909,402 (GRCm39) K549T probably benign Het
Aoc2 G T 11: 101,217,246 (GRCm39) G443V probably benign Het
Aox4 G C 1: 58,285,510 (GRCm39) E665Q possibly damaging Het
Ap1m2 G A 9: 21,209,552 (GRCm39) R375* probably null Het
Ap1s1 G A 5: 137,066,324 (GRCm39) T126I probably damaging Het
Apba1 C A 19: 23,921,479 (GRCm39) S767R probably damaging Het
Apex2 C A X: 149,355,095 (GRCm39) G414V probably benign Het
Apoa4 C A 9: 46,153,887 (GRCm39) R163S possibly damaging Het
Apob G T 12: 8,054,978 (GRCm39) V1326L probably benign Het
Apob G C 12: 8,048,011 (GRCm39) G997R probably damaging Het
Apobr A T 7: 126,186,436 (GRCm39) E649V probably damaging Het
Apoh G T 11: 108,234,285 (GRCm39) probably benign Het
Apol11b A C 15: 77,522,207 (GRCm39) I30R probably benign Het
App A G 16: 84,821,805 (GRCm39) L390P probably damaging Het
Aqr C A 2: 113,938,603 (GRCm39) R1283M probably damaging Het
Aqr C G 2: 113,940,472 (GRCm39) A1225P probably benign Het
Ar G T X: 97,194,615 (GRCm39) G410W probably damaging Het
Arfgef2 G A 2: 166,736,632 (GRCm39) R1768Q probably damaging Het
Arfgef3 T A 10: 18,510,600 (GRCm39) H787L probably benign Het
Arfgef3 C A 10: 18,484,106 (GRCm39) C1383F probably damaging Het
Arfgef3 T A 10: 18,467,185 (GRCm39) K2005M probably damaging Het
Arhgap1 C T 2: 91,480,559 (GRCm39) A27V possibly damaging Het
Arhgap10 T G 8: 78,159,434 (GRCm39) S107R probably damaging Het
Arhgap10 C A 8: 78,003,804 (GRCm39) G667V probably benign Het
Arhgap11a C G 2: 113,664,103 (GRCm39) A727P probably benign Het
Arhgap22 A T 14: 33,084,479 (GRCm39) R253W probably damaging Het
Arhgap24 G A 5: 103,028,673 (GRCm39) A283T probably benign Het
Arhgap24 G T 5: 103,023,625 (GRCm39) V220F probably damaging Het
Arhgap25 G T 6: 87,453,168 (GRCm39) L211M probably damaging Het
Arhgap31 G C 16: 38,444,255 (GRCm39) Q201E possibly damaging Het
Arhgap33 C A 7: 30,222,142 (GRCm39) R1263S probably benign Het
Arhgap40 C A 2: 158,376,805 (GRCm39) P317T probably benign Het
Arhgap45 C A 10: 79,861,370 (GRCm39) T511N probably damaging Het
Arhgap45 C G 10: 79,864,886 (GRCm39) R950G probably damaging Het
Arhgap5 G A 12: 52,565,246 (GRCm39) R739H possibly damaging Het
Arhgap9 C A 10: 127,163,558 (GRCm39) T452N probably damaging Het
Arhgef11 C T 3: 87,642,769 (GRCm39) P1434L not run Het
Arhgef12 T A 9: 42,882,368 (GRCm39) Q1492L probably benign Het
Arhgef18 G T 8: 3,503,224 (GRCm39) V877L probably damaging Het
Arhgef4 G T 1: 34,844,007 (GRCm39) G1358C probably damaging Het
Arhgef4 G T 1: 34,762,810 (GRCm39) D689Y unknown Het
Arid1a C A 4: 133,447,861 (GRCm39) Q217H probably null Het
Arid4a A C 12: 71,086,694 (GRCm39) K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,358,436 (GRCm39) probably null Het
Arl10 C G 13: 54,728,537 (GRCm39) L188V probably benign Het
Arl14 C A 3: 69,129,981 (GRCm39) P43T probably damaging Het
Arl4c T C 1: 88,629,172 (GRCm39) Q72R possibly damaging Het
Arl6ip5 C A 6: 97,206,516 (GRCm39) N65K probably benign Het
Armc2 C G 10: 41,839,652 (GRCm39) G438R probably damaging Het
Armc2 C A 10: 41,803,040 (GRCm39) Q544H probably damaging Het
Armcx4 C A X: 133,593,791 (GRCm39) A1233D not run Het
Armcx4 G A X: 133,594,840 (GRCm39) E1583K possibly damaging Het
Arnt2 G A 7: 83,912,404 (GRCm39) P579S probably benign Het
Arpc3 C T 5: 122,542,293 (GRCm39) P120L probably damaging Het
Arrdc5 C G 17: 56,607,189 (GRCm39) A19P probably damaging Het
Arsi C A 18: 61,049,852 (GRCm39) P245H probably damaging Het
Art2b T A 7: 101,228,089 (GRCm39) Q283L not run Het
Arx G T X: 92,332,790 (GRCm39) A280S probably damaging Het
Asap3 C A 4: 135,968,814 (GRCm39) P753Q probably damaging Het
Asap3 TGGG TGG 4: 135,967,512 (GRCm39) probably benign Het
Asb15 G T 6: 24,566,330 (GRCm39) D428Y probably damaging Het
Ascc1 G T 10: 59,843,615 (GRCm39) R59L possibly damaging Het
Ascc2 G C 11: 4,622,487 (GRCm39) G518R probably benign Het
Ascc2 G T 11: 4,596,653 (GRCm39) R58L probably benign Het
Ash1l G A 3: 88,950,524 (GRCm39) R2139Q probably damaging Het
Asic2 T G 11: 81,858,496 (GRCm39) K172T probably benign Het
Asic2 A T 11: 80,780,658 (GRCm39) L417Q possibly damaging Het
Aspg C G 12: 112,079,515 (GRCm39) Q98E possibly damaging Het
Asphd1 A T 7: 126,547,808 (GRCm39) L165Q probably damaging Het
Astl C T 2: 127,198,465 (GRCm39) A360V probably benign Het
Asxl3 G T 18: 22,655,277 (GRCm39) G1096C probably damaging Het
Atad5 A C 11: 79,985,722 (GRCm39) S270R probably damaging Het
Ate1 C A 7: 130,106,444 (GRCm39) D306Y probably benign Het
Atg7 G T 6: 114,650,011 (GRCm39) V63F possibly damaging Het
Atg9a A T 1: 75,163,203 (GRCm39) L299Q probably damaging Het
Atl1 C G 12: 69,983,849 (GRCm39) L192V possibly damaging Het
Atl3 T G 19: 7,487,402 (GRCm39) F106V probably damaging Het
Atp10a G T 7: 58,438,195 (GRCm39) probably null Het
Atp12a G C 14: 56,610,163 (GRCm39) G221A probably damaging Het
Atp13a2 A T 4: 140,732,428 (GRCm39) S898C probably benign Het
Atp13a4 C A 16: 29,241,405 (GRCm39) Q754H probably null Het
Atp1a2 A T 1: 172,107,321 (GRCm39) I733N possibly damaging Het
Atp1a3 C A 7: 24,698,113 (GRCm39) A198S probably benign Het
Atp1a4 C G 1: 172,059,521 (GRCm39) R857P probably benign Het
Atp1b2 G T 11: 69,492,141 (GRCm39) A269D possibly damaging Het
Atp2a3 G T 11: 72,871,448 (GRCm39) G650C possibly damaging Het
Atp2a3 C A 11: 72,880,366 (GRCm39) H1016N probably benign Het
Atp2b3 G A X: 72,579,030 (GRCm39) E343K possibly damaging Het
Atp6v0a4 G A 6: 38,025,971 (GRCm39) S819F possibly damaging Het
Atp6v1e1 T C 6: 120,781,080 (GRCm39) E97G probably benign Het
Atp6v1e1 T A 6: 120,799,410 (GRCm39) probably benign Het
Atp6v1h G C 1: 5,165,851 (GRCm39) R107P probably damaging Het
Atp7b G T 8: 22,518,730 (GRCm39) P36H probably benign Het
Atp8b4 C A 2: 126,256,349 (GRCm39) E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 (GRCm39) R650W probably benign Het
Atp9b T A 18: 80,809,080 (GRCm39) Q613L Het
Atpaf2 C A 11: 60,307,601 (GRCm39) A46S probably benign Het
Atrn G T 2: 130,788,113 (GRCm39) G305V probably benign Het
Atxn2 A T 5: 121,916,053 (GRCm39) S420C probably damaging Het
Atxn7l1 G T 12: 33,417,644 (GRCm39) A602S probably benign Het
Atxn7l1 G C 12: 33,418,016 (GRCm39) A726P probably benign Het
Atxn7l2 A C 3: 108,112,982 (GRCm39) S309A probably benign Het
Aup1 G T 6: 83,033,614 (GRCm39) R306L probably benign Het
Aurkaip1 G T 4: 155,917,220 (GRCm39) R156L probably damaging Het
Aurkc TGG TG 7: 6,998,513 (GRCm39) probably null Het
Avl9 G C 6: 56,713,749 (GRCm39) D336H probably damaging Het
Avpr1b C A 1: 131,537,311 (GRCm39) S365Y probably damaging Het
Axdnd1 A T 1: 156,176,633 (GRCm39) L714Q probably damaging Het
Azin2 C A 4: 128,828,452 (GRCm39) D347Y possibly damaging Het
B3gnt5 A T 16: 19,588,560 (GRCm39) R260* probably null Het
B3gnt6 C G 7: 97,843,096 (GRCm39) R288P probably benign Het
Bag6 G T 17: 35,358,286 (GRCm39) probably null Het
Bahcc1 G T 11: 120,175,220 (GRCm39) V1765L probably benign Het
Bahcc1 G T 11: 120,167,435 (GRCm39) G1279W possibly damaging Het
Bahd1 G A 2: 118,752,884 (GRCm39) R717H probably damaging Het
Baiap3 C A 17: 25,463,742 (GRCm39) R934S probably benign Het
Bbln C A 2: 32,271,776 (GRCm39) G3C possibly damaging Het
Bbs10 G T 10: 111,136,985 (GRCm39) R699S probably damaging Het
Bbs10 G T 10: 111,135,518 (GRCm39) L210F probably benign Het
Bbs10 G C 10: 111,134,769 (GRCm39) probably null Het
BC024063 G T 10: 81,944,884 (GRCm39) G168V probably damaging Het
Bcan T G 3: 87,898,062 (GRCm39) N633T probably damaging Het
Bcan C A 3: 87,898,057 (GRCm39) G635W probably damaging Het
Bcan C T 3: 87,902,957 (GRCm39) D274N probably benign Het
Bckdha T C 7: 25,330,568 (GRCm39) S343G probably damaging Het
Bcl10 T G 3: 145,636,268 (GRCm39) I55M probably damaging Het
Bcl11a G T 11: 24,115,010 (GRCm39) K784N probably damaging Het
Bcl6 C G 16: 23,788,708 (GRCm39) Q553H probably damaging Het
Bcorl1 T G X: 47,456,719 (GRCm39) L84R unknown Het
Bcorl1 GAAAA GAAA X: 47,463,967 (GRCm39) probably null Het
Bend6 C A 1: 33,903,604 (GRCm39) Q173H probably null Het
Best3 T G 10: 116,860,527 (GRCm39) L596V probably benign Het
Bltp3a C G 17: 28,095,650 (GRCm39) L20V probably damaging Het
Bltp3a G A 17: 28,105,280 (GRCm39) R602H probably damaging Het
Bmerb1 C A 16: 13,867,345 (GRCm39) R68S probably damaging Het
Bmp4 A C 14: 46,622,085 (GRCm39) V153G possibly damaging Het
Bmpr1b C A 3: 141,548,715 (GRCm39) E438D probably benign Het
Bmpr2 G A 1: 59,886,326 (GRCm39) R321Q not run Het
Bnc1 T G 7: 81,624,290 (GRCm39) E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,621,767 (GRCm39) probably benign Het
Borcs5 A T 6: 134,687,086 (GRCm39) Q147L probably benign Het
Borcs8 C G 8: 70,594,621 (GRCm39) H49D probably damaging Het
Bpi G T 2: 158,114,022 (GRCm39) G307W possibly damaging Het
Bpifa3 A T 2: 153,972,391 (GRCm39) probably benign Het
Bpifb4 A C 2: 153,784,752 (GRCm39) E153D probably benign Het
Bpifc C A 10: 85,801,092 (GRCm39) A419S probably benign Het
Bptf C A 11: 106,949,510 (GRCm39) G2270W probably damaging Het
Braf C A 6: 39,620,116 (GRCm39) W487C probably damaging Het
Brap A G 5: 121,813,440 (GRCm39) T298A possibly damaging Het
Brd2 C A 17: 34,332,662 (GRCm39) G573W possibly damaging Het
Brd9 G C 13: 74,092,870 (GRCm39) A287P probably damaging Het
Brdt G T 5: 107,507,764 (GRCm39) S664I possibly damaging Het
Brinp1 C A 4: 68,716,988 (GRCm39) E287* probably null Het
Brinp2 A T 1: 158,074,741 (GRCm39) L460* probably null Het
Brinp2 C G 1: 158,074,609 (GRCm39) G504A probably damaging Het
Brinp3 C T 1: 146,777,814 (GRCm39) P754S probably damaging Het
Btg4 G A 9: 51,030,475 (GRCm39) D192N probably benign Het
Btla G T 16: 45,059,721 (GRCm39) V142L probably damaging Het
Bub1 C A 2: 127,671,485 (GRCm39) W33L probably damaging Het
C1qb C G 4: 136,609,456 (GRCm39) G55R probably damaging Het
C1ql2 C G 1: 120,269,353 (GRCm39) H169Q possibly damaging Het
C2cd4a C G 9: 67,738,695 (GRCm39) G116A probably damaging Het
C2cd4c G A 10: 79,448,299 (GRCm39) P283S possibly damaging Het
C4b A T 17: 34,950,121 (GRCm39) L1383Q probably damaging Het
C8a C A 4: 104,719,883 (GRCm39) G76C probably damaging Het
Cabp7 T G 11: 4,696,669 (GRCm39) N20T probably benign Het
Cacna1a G T 8: 85,142,305 (GRCm39) R11L unknown Het
Cacna1b A T 2: 24,516,896 (GRCm39) L54* probably null Het
Cacna1c T G 6: 118,674,698 (GRCm39) K547T Het
Cacna1d C T 14: 29,833,073 (GRCm39) A923T probably benign Het
Cacna1d A G 14: 29,901,145 (GRCm39) F325S probably benign Het
Cacna1e T A 1: 154,511,596 (GRCm39) T176S probably damaging Het
Cacna1g A T 11: 94,328,937 (GRCm39) L1020M probably benign Het
Cacna1h G C 17: 25,610,224 (GRCm39) P761A probably benign Het
Cacna1s G T 1: 136,034,822 (GRCm39) E1322* probably null Het
Cacna2d2 G C 9: 107,394,492 (GRCm39) A585P probably damaging Het
Cacna2d2 C A 9: 107,403,301 (GRCm39) L921M probably benign Het
Cacna2d4 G T 6: 119,289,411 (GRCm39) R815M probably benign Het
Cacnb1 C A 11: 97,913,381 (GRCm39) probably benign Het
Cacnb4 C A 2: 52,565,824 (GRCm39) probably null Het
Cacng5 C G 11: 107,775,172 (GRCm39) G66R probably null Het
Cacng5 G T 11: 107,768,372 (GRCm39) P212T probably damaging Het
Cadps2 A C 6: 23,321,800 (GRCm39) L1031V probably benign Het
Calcoco2 C A 11: 95,994,346 (GRCm39) W69L probably damaging Het
Calr C A 8: 85,570,693 (GRCm39) probably null Het
Camk1g C A 1: 193,044,408 (GRCm39) G2V probably damaging Het
Camk2b G C 11: 5,927,940 (GRCm39) S447C possibly damaging Het
Camk2g C A 14: 20,814,980 (GRCm39) W215C probably damaging Het
Camsap1 G C 2: 25,830,893 (GRCm39) P461A probably benign Het
Camsap1 C T 2: 25,826,651 (GRCm39) A1260T probably damaging Het
Camta1 G T 4: 151,228,842 (GRCm39) H663Q probably benign Het
Cand1 A C 10: 119,075,099 (GRCm39) I16S probably benign Het
Capg G T 6: 72,532,459 (GRCm39) probably null Het
Capn1 C G 19: 6,064,308 (GRCm39) V64L probably benign Het
Capn13 G T 17: 73,648,105 (GRCm39) S298R probably benign Het
Capn6 C G X: 142,593,903 (GRCm39) G79R probably damaging Het
Car5b G T X: 162,783,306 (GRCm39) A90D probably benign Het
Car7 G T 8: 105,275,591 (GRCm39) C180F possibly damaging Het
Card9 T A 2: 26,247,808 (GRCm39) E181V probably damaging Het
Carnmt1 C G 19: 18,656,577 (GRCm39) A170G possibly damaging Het
Carnmt1 G C 19: 18,681,454 (GRCm39) C391S probably benign Het
Cartpt C A 13: 100,036,491 (GRCm39) E86* probably null Het
Cask C T X: 13,399,728 (GRCm39) V785I probably benign Het
Caskin1 C A 17: 24,724,012 (GRCm39) N933K probably damaging Het
Caskin2 C A 11: 115,694,446 (GRCm39) G385V probably benign Het
Caskin2 C G 11: 115,692,929 (GRCm39) A619P probably damaging Het
Caskin2 A G 11: 115,692,922 (GRCm39) L621P probably damaging Het
Casq1 G T 1: 172,043,481 (GRCm39) S191* probably null Het
Casz1 T C 4: 149,028,816 (GRCm39) L1087P probably benign Het
Catip A C 1: 74,406,948 (GRCm39) H240P probably damaging Het
Catsper2 C A 2: 121,237,866 (GRCm39) W171C probably damaging Het
Cav2 G T 6: 17,281,432 (GRCm39) V25F probably benign Het
Cavin2 G T 1: 51,340,315 (GRCm39) G331C probably damaging Het
Cbfa2t3 G C 8: 123,425,634 (GRCm39) probably benign Het
Cbx8 G A 11: 118,929,945 (GRCm39) A216V possibly damaging Het
Ccdc113 G T 8: 96,264,847 (GRCm39) R119L probably damaging Het
Ccdc121rt1 C T 1: 181,338,440 (GRCm39) E171K possibly damaging Het
Ccdc121rt2 T C 5: 112,597,741 (GRCm39) V96A probably benign Het
Ccdc14 G T 16: 34,526,868 (GRCm39) G306C probably damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,578,155 (GRCm39) probably null Het
Ccdc158 T C 5: 92,756,350 (GRCm39) M1086V probably damaging Het
Ccdc162 C T 10: 41,481,104 (GRCm39) D1318N possibly damaging Het
Ccdc162 C T 10: 41,429,127 (GRCm39) R645H probably benign Het
Ccdc162 T G 10: 41,566,088 (GRCm39) K85T probably benign Het
Ccdc162 G A 10: 41,530,993 (GRCm39) T571I possibly damaging Het
Ccdc171 G A 4: 83,713,467 (GRCm39) A1169T probably damaging Het
Ccdc175 C A 12: 72,159,082 (GRCm39) R619L possibly damaging Het
Ccdc180 A C 4: 45,916,406 (GRCm39) K869T probably damaging Het
Ccdc180 A C 4: 45,920,910 (GRCm39) K952T probably damaging Het
Ccdc187 G T 2: 26,171,519 (GRCm39) Q320K probably benign Het
Ccdc28b C A 4: 129,514,897 (GRCm39) G71C probably damaging Het
Ccdc33 G A 9: 58,024,699 (GRCm39) P176S probably benign Het
Ccdc40 G A 11: 119,142,834 (GRCm39) R864H probably damaging Het
Ccdc51 G T 9: 108,921,216 (GRCm39) E368* probably null Het
Ccdc51 G C 9: 108,921,294 (GRCm39) A394P probably damaging Het
Ccdc57 C A 11: 120,751,964 (GRCm39) Q872H probably null Het
Ccdc57 C G 11: 120,751,314 (GRCm39) A919P possibly damaging Het
Ccdc7a G T 8: 129,753,144 (GRCm39) R196S probably benign Het
Ccdc80 T C 16: 44,936,707 (GRCm39) F711L probably damaging Het
Ccdc80 G A 16: 44,916,570 (GRCm39) S442N probably benign Het
Ccdc80 G T 16: 44,916,149 (GRCm39) G302* probably null Het
Ccdc87 G A 19: 4,891,951 (GRCm39) W814* probably null Het
Ccdc88b C A 19: 6,827,108 (GRCm39) A1020S possibly damaging Het
Ccdc88c T C 12: 100,912,029 (GRCm39) K602E possibly damaging Het
Ccdc96 C G 5: 36,642,938 (GRCm39) R315G probably benign Het
Ccin A T 4: 43,985,018 (GRCm39) Q475L probably damaging Het
Ccnb1ip1 C A 14: 51,029,561 (GRCm39) R167L probably benign Het
Ccnb3 T C X: 6,875,614 (GRCm39) T322A possibly damaging Het
Ccr10 C G 11: 101,065,149 (GRCm39) G127A probably damaging Het
Ccr10 CG C 11: 101,065,166 (GRCm39) probably null Het
Ccr7 G T 11: 99,035,806 (GRCm39) T372N probably damaging Het
Cct6b C A 11: 82,654,891 (GRCm39) probably benign Het
Cct6b C T 11: 82,614,765 (GRCm39) V408I probably damaging Het
Cd164 G T 10: 41,395,561 (GRCm39) A11S probably damaging Het
Cd177 G T 7: 24,445,596 (GRCm39) Q616K probably benign Het
Cd180 C T 13: 102,842,274 (GRCm39) P440L probably damaging Het
Cd200r1 A T 16: 44,613,122 (GRCm39) I243F probably damaging Het
Cd209e C T 8: 3,899,196 (GRCm39) G172E probably benign Het
Cd22 G T 7: 30,568,955 (GRCm39) P693H probably damaging Het
Cd22 T G 7: 30,567,388 (GRCm39) K732T probably benign Het
Cd3d A G 9: 44,896,926 (GRCm39) D100G probably damaging Het
Cd59a C A 2: 103,934,543 (GRCm39) Q4K probably benign Het
Cd69 G T 6: 129,245,305 (GRCm39) C173* probably null Het
Cdc123 T G 2: 5,809,796 (GRCm39) Q205P probably damaging Het
Cdc14b C G 13: 64,422,483 (GRCm39) V28L possibly damaging Het
Cdc42bpa A G 1: 179,892,658 (GRCm39) E274G probably damaging Het
Cdc42ep2 A G 19: 5,968,520 (GRCm39) F62L probably benign Het
Cdc42ep5 A T 7: 4,154,725 (GRCm39) L21H probably damaging Het
Cdh15 G C 8: 123,590,998 (GRCm39) D416H probably damaging Het
Cdh16 G C 8: 105,341,817 (GRCm39) P783A probably damaging Het
Cdh19 A T 1: 110,823,117 (GRCm39) N522K probably damaging Het
Cdh19 T G 1: 110,821,036 (GRCm39) Q567H probably benign Het
Cdh19 C G 1: 110,859,944 (GRCm39) G179A probably damaging Het
Cdh20 G T 1: 110,036,466 (GRCm39) G549C probably damaging Het
Cdh22 G T 2: 164,958,104 (GRCm39) P621H probably damaging Het
Cdh23 T A 10: 60,146,549 (GRCm39) N2877Y probably damaging Het
Cdh23 T C 10: 60,264,100 (GRCm39) N683D probably benign Het
Cdh8 C A 8: 99,916,837 (GRCm39) R426M probably null Het
Cdh8 G A 8: 99,897,955 (GRCm39) P453S probably benign Het
Cdhr3 C A 12: 33,130,323 (GRCm39) G171W probably benign Het
Cdhr3 G T 12: 33,110,321 (GRCm39) P321H probably damaging Het
Cdk12 G T 11: 98,094,767 (GRCm39) G192* probably null Het
Cdk14 G T 5: 5,185,322 (GRCm39) Y212* probably null Het
Cdk5r2 C G 1: 74,894,509 (GRCm39) P85A probably damaging Het
Cdk5rap2 C T 4: 70,184,980 (GRCm39) G1157R probably damaging Het
Cdk6 T A 5: 3,440,694 (GRCm39) C83S possibly damaging Het
Cdsn T G 17: 35,866,722 (GRCm39) V417G possibly damaging Het
Cdsn T A 17: 35,866,968 (GRCm39) L499Q probably damaging Het
Cdyl C T 13: 35,999,949 (GRCm39) R77W probably damaging Het
Ceacam15 G T 7: 16,409,508 (GRCm39) P9H possibly damaging Het
Cela2a G T 4: 141,548,702 (GRCm39) P145T probably damaging Het
Celsr1 A C 15: 85,847,301 (GRCm39) F1479V probably damaging Het
Celsr2 C A 3: 108,300,447 (GRCm39) R2871L probably benign Het
Celsr2 G T 3: 108,319,657 (GRCm39) H1052N probably benign Het
Cenpf G A 1: 189,391,669 (GRCm39) T704I probably damaging Het
Cenpv A C 11: 62,418,351 (GRCm39) F201V probably damaging Het
Cep112 G A 11: 108,316,136 (GRCm39) G36D probably damaging Het
Cep152 C A 2: 125,425,891 (GRCm39) G825C probably benign Het
Cep170b G T 12: 112,707,446 (GRCm39) probably null Het
Cep192 A T 18: 68,014,359 (GRCm39) K2451M probably damaging Het
Cep290 AGG AG 10: 100,385,236 (GRCm39) probably benign Het
Cep295 G T 9: 15,268,993 (GRCm39) P16Q probably damaging Het
Cep295nl T C 11: 118,223,845 (GRCm39) E333G possibly damaging Het
Cep295nl T G 11: 118,224,699 (GRCm39) Q48H probably damaging Het
Cep44 C G 8: 56,997,163 (GRCm39) G125A possibly damaging Het
Cep97 C A 16: 55,748,098 (GRCm39) G111C probably damaging Het
Cerkl C A 2: 79,199,109 (GRCm39) Q160H probably benign Het
Cers1 C G 8: 70,770,968 (GRCm39) P126R probably benign Het
Ces1a C A 8: 93,762,713 (GRCm39) R186L probably benign Het
Ces1g G T 8: 94,052,439 (GRCm39) H283Q probably benign Het
Ces2a C A 8: 105,460,638 (GRCm39) probably benign Het
Ces2a A T 8: 105,461,482 (GRCm39) E77V probably damaging Het
Ces3a A C 8: 105,780,234 (GRCm39) K327T possibly damaging Het
Ces4a A G 8: 105,858,609 (GRCm39) K9R probably benign Het
Cetn2 T G X: 71,958,495 (GRCm39) K127T probably damaging Het
Cfap100 G C 6: 90,383,132 (GRCm39) A347G unknown Het
Cfap20 C T 8: 96,161,153 (GRCm39) S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 (GRCm39) P251R possibly damaging Het
Cfap221 G T 1: 119,922,871 (GRCm39) L24I probably benign Het
Cfap45 G T 1: 172,372,851 (GRCm39) E515D probably benign Het
Cfap46 A C 7: 139,219,464 (GRCm39) L1334V Het
Cfap65 G A 1: 74,949,906 (GRCm39) R1200C probably damaging Het
Cfap68 C A 9: 50,679,519 (GRCm39) probably benign Het
Cfap74 C G 4: 155,510,575 (GRCm39) R387G Het
Cfhr4 G C 1: 139,661,186 (GRCm39) C554W probably damaging Het
Cfhr4 G T 1: 139,625,994 (GRCm39) R827S probably benign Het
Cflar G T 1: 58,779,472 (GRCm39) probably null Het
Cflar C G 1: 58,770,388 (GRCm39) C160W Het
Cgn G T 3: 94,683,488 (GRCm39) A389D probably benign Het
Cgn A T 3: 94,681,583 (GRCm39) V504E possibly damaging Het
Cgn T C 3: 94,681,656 (GRCm39) R480G probably damaging Het
Chd1 G T 17: 15,986,609 (GRCm39) V1482L probably damaging Het
Chd1 G T 17: 15,988,995 (GRCm39) G1583C probably damaging Het
Chd4 G T 6: 125,078,561 (GRCm39) A228S probably benign Het
Chd4 G T 6: 125,077,823 (GRCm39) R95L possibly damaging Het
Chd5 G A 4: 152,462,936 (GRCm39) R1363K probably damaging Het
Chd7 C G 4: 8,844,313 (GRCm39) A1502G probably damaging Het
Cherp C T 8: 73,224,797 (GRCm39) G101D Het
Chfr C G 5: 110,292,761 (GRCm39) S176* probably null Het
Chi3l1 C G 1: 134,116,968 (GRCm39) R319G probably damaging Het
Chi3l1 G T 1: 134,110,517 (GRCm39) probably null Het
Chml C A 1: 175,515,328 (GRCm39) G198C possibly damaging Het
Chmp3 A C 6: 71,537,948 (GRCm39) E58D probably benign Het
Chmp3 G C 6: 71,556,759 (GRCm39) A220P probably damaging Het
Chpf G C 1: 75,452,114 (GRCm39) L609V probably damaging Het
Chpf C G 1: 75,452,102 (GRCm39) A613P probably benign Het
Chrna2 C A 14: 66,386,753 (GRCm39) L300M probably damaging Het
Chrna5 G T 9: 54,911,766 (GRCm39) G189C probably damaging Het
Chrna7 A T 7: 62,861,932 (GRCm39) L40Q probably damaging Het
Chst3 T A 10: 60,021,498 (GRCm39) R450W possibly damaging Het
Chst4 A C 8: 110,756,724 (GRCm39) F380V probably damaging Het
Chsy1 C G 7: 65,821,974 (GRCm39) S736R probably damaging Het
Cic A C 7: 24,970,444 (GRCm39) E58D possibly damaging Het
Cidea A G 18: 67,491,923 (GRCm39) K61R probably null Het
Ciita C A 16: 10,326,564 (GRCm39) P252T probably damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cimap2 G T 4: 106,464,497 (GRCm39) D387E probably benign Het
Cimip2b A G 4: 43,427,172 (GRCm39) S87P Het
Cimip2b G T 4: 43,427,171 (GRCm39) S87Y Het
Cimip3 T G 17: 47,724,659 (GRCm39) N154T probably benign Het
Cipc G T 12: 87,007,111 (GRCm39) G103C probably damaging Het
Cit G C 5: 116,124,662 (GRCm39) G1526R probably damaging Het
Cited4 C A 4: 120,524,011 (GRCm39) H4Q probably damaging Het
Ckap2 G A 8: 22,659,810 (GRCm39) P557L probably damaging Het
Ckap2l C A 2: 129,127,282 (GRCm39) D299Y probably damaging Het
Clca3a1 G T 3: 144,719,682 (GRCm39) S429R probably damaging Het
Clcn1 T C 6: 42,284,501 (GRCm39) V613A probably damaging Het
Cldn11 T A 3: 31,204,455 (GRCm39) W53R probably damaging Het
Cldn18 T A 9: 99,580,900 (GRCm39) K116M possibly damaging Het
Cldn23 A T 8: 36,293,431 (GRCm39) L19Q probably damaging Het
Cldn34b1 T G X: 153,670,704 (GRCm39) K5T probably benign Het
Clec4d T G 6: 123,251,645 (GRCm39) F176V probably benign Het
Clic1 G T 17: 35,271,435 (GRCm39) G22W probably damaging Het
Clic6 G A 16: 92,295,783 (GRCm39) D148N probably benign Het
Clip3 A C 7: 29,998,263 (GRCm39) E236D probably benign Het
Clk1 C A 1: 58,456,531 (GRCm39) R186L probably benign Het
Clstn3 C T 6: 124,436,159 (GRCm39) V234M probably damaging Het
Cltc A G 11: 86,593,458 (GRCm39) V1525A probably benign Het
Cmklr1 T A 5: 113,751,952 (GRCm39) S350C probably damaging Het
Cmya5 C G 13: 93,233,298 (GRCm39) D597H unknown Het
Cmya5 C G 13: 93,200,087 (GRCm39) A3414P probably benign Het
Cnksr1 A T 4: 133,959,446 (GRCm39) L396Q probably damaging Het
Cnksr3 C T 10: 7,084,544 (GRCm39) R308Q probably damaging Het
Cnnm4 G T 1: 36,544,832 (GRCm39) R697L possibly damaging Het
Cnot1 C G 8: 96,474,905 (GRCm39) Q1103H possibly damaging Het
Cnot8 C G 11: 58,003,916 (GRCm39) A117G probably benign Het
Cnppd1 C A 1: 75,117,595 (GRCm39) G42V probably damaging Het
Cntn2 C A 1: 132,455,526 (GRCm39) R237L probably damaging Het
Cntn3 T G 6: 102,414,892 (GRCm39) probably null Het
Cntn4 T G 6: 106,486,425 (GRCm39) N284K probably benign Het
Cntn4 T G 6: 106,500,524 (GRCm39) F334V probably benign Het
Cntnap1 C A 11: 101,073,724 (GRCm39) T625K probably damaging Het
Cntnap2 A C 6: 47,248,082 (GRCm39) K1163Q probably benign Het
Cntnap3 AC A 13: 64,888,686 (GRCm39) probably null Het
Cntnap3 T G 13: 64,940,202 (GRCm39) N332H probably damaging Het
Cntnap4 A T 8: 113,584,821 (GRCm39) K1086M possibly damaging Het
Cntnap5a T A 1: 116,356,246 (GRCm39) V759E probably damaging Het
Cntnap5b C A 1: 99,894,995 (GRCm39) T89K probably damaging Het
Cntnap5b C A 1: 100,091,953 (GRCm39) S231R possibly damaging Het
Cntnap5b C G 1: 100,374,565 (GRCm39) Q734E probably benign Het
Cobl C A 11: 12,319,645 (GRCm39) E244D probably damaging Het
Cobl G A 11: 12,325,827 (GRCm39) A223V probably damaging Het
Cobl G T 11: 12,203,433 (GRCm39) Q1090K probably benign Het
Cog1 C A 11: 113,542,808 (GRCm39) H151Q probably damaging Het
Coil C A 11: 88,872,802 (GRCm39) P388T probably damaging Het
Col10a1 C A 10: 34,271,174 (GRCm39) P382H probably damaging Het
Col11a2 G T 17: 34,275,376 (GRCm39) G420C unknown Het
Col16a1 G C 4: 129,966,671 (GRCm39) G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,637,868 (GRCm39) probably benign Het
Col18a1 G C 10: 76,891,543 (GRCm39) A1097G possibly damaging Het
Col18a1 C A 10: 76,948,685 (GRCm39) A276S unknown Het
Col1a2 A C 6: 4,532,750 (GRCm39) T792P unknown Het
Col23a1 G T 11: 51,440,535 (GRCm39) D142Y unknown Het
Col24a1 G A 3: 145,048,259 (GRCm39) G619S probably damaging Het
Col25a1 AC A 3: 129,976,444 (GRCm39) probably null Het
Col27a1 C G 4: 63,144,025 (GRCm39) S571C probably damaging Het
Col5a1 G A 2: 27,892,529 (GRCm39) R1014H unknown Het
Col5a2 C A 1: 45,415,306 (GRCm39) V1478L possibly damaging Het
Col5a2 C G 1: 45,435,644 (GRCm39) G697A probably benign Het
Col5a2 C A 1: 45,422,840 (GRCm39) G1126C probably damaging Het
Col6a4 T C 9: 105,877,996 (GRCm39) S1994G probably benign Het
Col6a4 G C 9: 105,878,069 (GRCm39) C1969W probably damaging Het
Col6a6 G C 9: 105,658,151 (GRCm39) A687G probably damaging Het
Col9a1 C A 1: 24,253,669 (GRCm39) P464H probably damaging Het
Col9a2 C G 4: 120,910,994 (GRCm39) A543G probably damaging Het
Colec11 C A 12: 28,645,283 (GRCm39) Q129H probably damaging Het
Commd10 G T 18: 47,123,633 (GRCm39) G163* probably null Het
Commd2 C A 3: 57,554,278 (GRCm39) R141L probably damaging Het
Copb2 A C 9: 98,468,199 (GRCm39) K737T probably benign Het
Coq3 C A 4: 21,899,102 (GRCm39) P145H probably damaging Het
Coq4 G T 2: 29,685,461 (GRCm39) Q158H probably null Het
Coq6 G C 12: 84,417,737 (GRCm39) A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,358,691 (GRCm39) probably null Het
Cox6a1 C T 5: 115,483,967 (GRCm39) G92S probably damaging Het
Cox6b2 C A 7: 4,755,146 (GRCm39) V43L probably benign Het
Cpeb1 C A 7: 81,009,476 (GRCm39) probably null Het
Cpeb2 G T 5: 43,392,060 (GRCm39) G419C Het
Cpne1 C A 2: 155,919,564 (GRCm39) D302Y probably damaging Het
Cpq A C 15: 33,381,537 (GRCm39) D300A probably damaging Het
Cps1 CTT CT 1: 67,187,878 (GRCm39) probably null Het
Cps1 G T 1: 67,162,427 (GRCm39) G35V possibly damaging Het
Cpsf4 A T 5: 145,104,225 (GRCm39) E20V possibly damaging Het
Cr2 G T 1: 194,836,461 (GRCm39) Q901K probably benign Het
Cracd C A 5: 77,005,093 (GRCm39) P485T unknown Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Crb2 C T 2: 37,666,383 (GRCm39) P11S probably benign Het
Crebl2 G T 6: 134,826,252 (GRCm39) E68* probably null Het
Crem T A 18: 3,267,730 (GRCm39) E258V probably damaging Het
Crispld1 C A 1: 17,798,837 (GRCm39) probably benign Het
Crispld1 G T 1: 17,823,075 (GRCm39) A381S possibly damaging Het
Crtac1 T G 19: 42,276,365 (GRCm39) E521A probably benign Het
Cry1 C A 10: 84,980,061 (GRCm39) V416L probably benign Het
Crybg2 C A 4: 133,809,971 (GRCm39) P1241H probably damaging Het
Cryz A T 3: 154,327,406 (GRCm39) T277S probably benign Het
Csmd1 T A 8: 16,087,212 (GRCm39) T1946S probably damaging Het
Csmd1 T C 8: 16,048,814 (GRCm39) D2296G probably damaging Het
Cspg5 G T 9: 110,080,118 (GRCm39) A429S probably damaging Het
Ctbp2 C A 7: 132,617,019 (GRCm39) probably benign Het
Ctf2 T A 7: 127,318,628 (GRCm39) I124F possibly damaging Het
Ctps1 G C 4: 120,399,940 (GRCm39) D472E probably benign Het
Ctsf C A 19: 4,906,334 (GRCm39) Q155K probably benign Het
Ctsj C T 13: 61,151,929 (GRCm39) E43K probably damaging Het
Ctsq C A 13: 61,184,937 (GRCm39) V250L probably benign Het
Cttnbp2 C A 6: 18,408,724 (GRCm39) G966C possibly damaging Het
Cttnbp2 G T 6: 18,420,835 (GRCm39) A892E possibly damaging Het
Cttnbp2 C A 6: 18,501,959 (GRCm39) E60* probably null Het
Cttnbp2 C A 6: 18,408,708 (GRCm39) S971I probably benign Het
Cubn T A 2: 13,386,636 (GRCm39) E1543V probably damaging Het
Cul9 C A 17: 46,831,511 (GRCm39) G1568* probably null Het
Cul9 C A 17: 46,831,502 (GRCm39) G1571* probably null Het
Cutal G T 2: 34,772,437 (GRCm39) R67I probably damaging Het
Cux2 C A 5: 122,011,876 (GRCm39) G520* probably null Het
Cux2 G T 5: 122,023,997 (GRCm39) T92K probably benign Het
Cxcr1 A T 1: 74,231,551 (GRCm39) L157* probably null Het
Cyb561d2 G C 9: 107,417,495 (GRCm39) C85W probably damaging Het
Cybb G A X: 9,306,240 (GRCm39) H494Y probably damaging Het
Cybb T C X: 9,304,479 (GRCm39) I564V probably damaging Het
Cyfip2 G A 11: 46,113,442 (GRCm39) S968F not run Het
Cylc1 G A X: 110,166,915 (GRCm39) V399I unknown Het
Cyp11b1 T A 15: 74,711,204 (GRCm39) K158I probably damaging Het
Cyp19a1 T A 9: 54,083,883 (GRCm39) K169* probably null Het
Cyp1a1 C A 9: 57,607,877 (GRCm39) S168R probably benign Het
Cyp26b1 T C 6: 84,554,096 (GRCm39) S174G probably benign Het
Cyp2a4 C T 7: 26,010,266 (GRCm39) P264S probably damaging Het
Cyp2a4 G T 7: 26,006,748 (GRCm39) G36* probably null Het
Cyp2a5 A C 7: 26,534,922 (GRCm39) N45T probably damaging Het
Cyp2a5 G A 7: 26,536,199 (GRCm39) R148H probably damaging Het
Cyp2c29 G A 19: 39,313,441 (GRCm39) M351I probably benign Het
Cyp2c54 G A 19: 40,034,659 (GRCm39) P337L probably damaging Het
Cyp2c55 C T 19: 39,023,957 (GRCm39) R344C probably benign Het
Cyp2j11 G T 4: 96,195,673 (GRCm39) S341Y probably damaging Het
Cyp2j11 T G 4: 96,195,540 (GRCm39) E385D probably damaging Het
Cyp2j5 G T 4: 96,517,743 (GRCm39) P490T probably damaging Het
Cyp2j6 C A 4: 96,424,305 (GRCm39) G151* probably null Het
Cyp39a1 A C 17: 44,041,939 (GRCm39) E382A probably damaging Het
Cyp39a1 A C 17: 44,036,468 (GRCm39) I333L probably benign Het
Cyp3a44 T C 5: 145,728,474 (GRCm39) K250R probably benign Het
Cyp4a10 G T 4: 115,375,523 (GRCm39) S2I probably damaging Het
Cyp4a12a G T 4: 115,186,200 (GRCm39) probably null Het
Cyp4a14 G C 4: 115,347,214 (GRCm39) A408G probably benign Het
Cyp4a30b G T 4: 115,328,156 (GRCm39) R475L possibly damaging Het
Cypt14-ps T C X: 38,952,432 (GRCm39) K10R possibly damaging Het
Cypt15-ps A C X: 38,435,261 (GRCm39) K33T possibly damaging Het
Cypt2 G T X: 104,543,405 (GRCm39) R3L probably benign Het
Cyth2 C A 7: 45,462,529 (GRCm39) R24L possibly damaging Het
Cytip C A 2: 58,024,049 (GRCm39) S257I probably damaging Het
Cytl1 G T 5: 37,893,039 (GRCm39) A50S probably benign Het
D430041D05Rik C A 2: 103,985,280 (GRCm39) L1262F probably damaging Het
D430041D05Rik C A 2: 104,087,201 (GRCm39) A592S probably benign Het
D5Ertd579e C G 5: 36,773,106 (GRCm39) E430Q probably benign Het
D930020B18Rik C A 10: 121,503,521 (GRCm39) A232D probably benign Het
Dab1 G C 4: 104,585,275 (GRCm39) V472L probably benign Het
Dab2ip G T 2: 35,598,880 (GRCm39) D191Y probably damaging Het
Dapk1 AC A 13: 60,908,618 (GRCm39) probably null Het
Dars1 C A 1: 128,299,944 (GRCm39) E347* probably null Het
Daw1 A C 1: 83,186,976 (GRCm39) K262T probably damaging Het
Daw1 C G 1: 83,158,112 (GRCm39) L54V probably damaging Het
Daw1 C A 1: 83,161,021 (GRCm39) T121K probably damaging Het
Dbh T A 2: 27,067,739 (GRCm39) L454Q probably damaging Het
Dcaf12l1 G A X: 43,878,774 (GRCm39) T8M probably benign Het
Dcaf8 G T 1: 172,000,496 (GRCm39) R218L probably benign Het
Dcdc2c G T 12: 28,574,706 (GRCm39) P139T probably benign Het
Dcxr GA G 11: 120,618,034 (GRCm39) probably null Het
Ddhd2 C T 8: 26,225,856 (GRCm39) M500I possibly damaging Het
Ddo C A 10: 40,523,929 (GRCm39) H306Q probably damaging Het
Ddr2 T C 1: 169,812,524 (GRCm39) Y656C probably damaging Het
Ddr2 T G 1: 169,825,653 (GRCm39) T316P probably benign Het
Ddr2 G T 1: 169,825,652 (GRCm39) T316N probably benign Het
Ddx51 G T 5: 110,802,424 (GRCm39) E176* probably null Het
Deaf1 C T 7: 140,881,387 (GRCm39) W573* probably null Het
Dedd2 C A 7: 24,903,023 (GRCm39) R312L probably damaging Het
Def8 G T 8: 124,186,705 (GRCm39) E428D possibly damaging Het
Defa21 T G 8: 21,515,739 (GRCm39) F46V probably benign Het
Defa27 A G 8: 21,805,614 (GRCm39) Q18R probably damaging Het
Defa27 C A 8: 21,805,613 (GRCm39) Q18K probably damaging Het
Defb14 G T 8: 19,245,136 (GRCm39) G38C probably damaging Het
Defb21 C A 2: 152,415,753 (GRCm39) P22H unknown Het
Defb26 C T 2: 152,350,221 (GRCm39) probably null Het
Dennd4b T G 3: 90,186,802 (GRCm39) L1425R probably damaging Het
Depdc5 A T 5: 33,100,626 (GRCm39) M846L possibly damaging Het
Dffb G T 4: 154,057,300 (GRCm39) L126M probably damaging Het
Dgat2l6 C A X: 99,568,556 (GRCm39) Q10K probably benign Het
Dgcr8 C T 16: 18,096,182 (GRCm39) probably null Het
Dgkb A G 12: 38,031,995 (GRCm39) Q19R possibly damaging Het
Dgkb C A 12: 38,186,612 (GRCm39) L254M probably damaging Het
Dgkd A C 1: 87,855,532 (GRCm39) S725R probably benign Het
Dgkg C A 16: 22,407,148 (GRCm39) A146S probably benign Het
Dglucy A C 12: 100,819,563 (GRCm39) K425T probably benign Het
Dhx30 C A 9: 109,916,033 (GRCm39) G722C probably damaging Het
Dhx34 G A 7: 15,952,569 (GRCm39) R19* probably null Het
Dhx57 T G 17: 80,553,234 (GRCm39) K1231T probably damaging Het
Diaph3 C A 14: 86,893,868 (GRCm39) C1136F probably benign Het
Dicer1 C G 12: 104,697,279 (GRCm39) A93P probably null Het
Dip2a T G 10: 76,116,654 (GRCm39) T890P probably damaging Het
Dip2a T A 10: 76,102,157 (GRCm39) S1446C possibly damaging Het
Disp3 G T 4: 148,335,414 (GRCm39) P908T probably damaging Het
Dlc1 C A 8: 37,051,365 (GRCm39) G338C probably damaging Het
Dlec1 C A 9: 118,967,854 (GRCm39) P1218T probably benign Het
Dlg4 G A 11: 69,932,746 (GRCm39) G512E probably benign Het
Dlgap1 C T 17: 71,122,204 (GRCm39) P878S probably damaging Het
Dll4 G T 2: 119,156,533 (GRCm39) probably benign Het
Dmbt1 T G 7: 130,690,542 (GRCm39) I925S unknown Het
Dmd A G X: 82,670,892 (GRCm39) K225R probably damaging Het
Dmd A T X: 82,922,090 (GRCm39) L1453F possibly damaging Het
Dmkn G T 7: 30,475,922 (GRCm39) W25L possibly damaging Het
Dmrt1 C T 19: 25,537,334 (GRCm39) T307I possibly damaging Het
Dmrt2 T C 19: 25,655,364 (GRCm39) L321P probably damaging Het
Dmrtb1 T A 4: 107,538,027 (GRCm39) D47V probably damaging Het
Dnaaf1 A C 8: 120,302,180 (GRCm39) D27A possibly damaging Het
Dnaaf10 A C 11: 17,178,184 (GRCm39) K226T probably damaging Het
Dnaaf2 G C 12: 69,244,624 (GRCm39) H146D probably damaging Het
Dnah10 G T 5: 124,852,419 (GRCm39) A1883S probably benign Het
Dnah11 A T 12: 118,094,534 (GRCm39) L845M probably damaging Het
Dnah11 C T 12: 117,894,912 (GRCm39) R3645H possibly damaging Het
Dnah11 A C 12: 118,090,854 (GRCm39) I1030S probably benign Het
Dnah14 G C 1: 181,584,916 (GRCm39) E3216Q possibly damaging Het
Dnah17 G T 11: 118,017,992 (GRCm39) L168M probably benign Het
Dnah2 G A 11: 69,312,647 (GRCm39) A4306V possibly damaging Het
Dnah2 C G 11: 69,407,349 (GRCm39) G478A probably damaging Het
Dnah2 T G 11: 69,407,307 (GRCm39) Y492S probably damaging Het
Dnah2 G A 11: 69,389,493 (GRCm39) H800Y probably benign Het
Dnah2 G C 11: 69,377,880 (GRCm39) N1317K possibly damaging Het
Dnah2 G T 11: 69,341,946 (GRCm39) Q2986K probably benign Het
Dnah3 A G 7: 119,567,026 (GRCm39) V13A Het
Dnah6 T A 6: 73,064,766 (GRCm39) E2605D possibly damaging Het
Dnah6 G T 6: 73,110,542 (GRCm39) T1681K probably benign Het
Dnah7a T G 1: 53,522,622 (GRCm39) K2872T probably damaging Het
Dnah7a A C 1: 53,458,858 (GRCm39) L3760R probably damaging Het
Dnah7c T C 1: 46,799,476 (GRCm39) F3379L possibly damaging Het
Dnah7c A T 1: 46,686,152 (GRCm39) probably null Het
Dnah7c G C 1: 46,678,825 (GRCm39) V1790L probably benign Het
Dnah7c G T 1: 46,654,441 (GRCm39) G107V probably damaging Het
Dnah7c T A 1: 46,506,462 (GRCm39) L180M probably benign Het
Dnah8 A G 17: 30,867,514 (GRCm39) K322R probably benign Het
Dnah9 C A 11: 65,963,661 (GRCm39) G1764V probably damaging Het
Dnah9 T A 11: 65,928,300 (GRCm39) Q2123L probably damaging Het
Dnah9 A T 11: 65,860,910 (GRCm39) L2820Q probably damaging Het
Dnah9 G T 11: 65,818,679 (GRCm39) L3220M probably damaging Het
Dnah9 T A 11: 65,786,798 (GRCm39) I3612F probably damaging Het
Dnai1 G T 4: 41,614,323 (GRCm39) R333L probably benign Het
Dnai4 T G 4: 102,929,968 (GRCm39) N341T probably benign Het
Dnai7 C A 6: 145,151,019 (GRCm39) E18* probably null Het
Dnajb6 G A 5: 29,957,443 (GRCm39) G75D possibly damaging Het
Dnajb8 A T 6: 88,199,892 (GRCm39) M143L possibly damaging Het
Dnajc1 C T 2: 18,298,798 (GRCm39) A259T possibly damaging Het
Dnajc11 G A 4: 152,018,240 (GRCm39) D11N probably benign Het
Dnajc28 G A 16: 91,413,921 (GRCm39) H108Y probably benign Het
Dner C A 1: 84,361,701 (GRCm39) R636L possibly damaging Het
Dnhd1 A T 7: 105,317,754 (GRCm39) K483M probably damaging Het
Dnhd1 G T 7: 105,327,506 (GRCm39) K50N probably benign Het
Dnhd1 A T 7: 105,352,243 (GRCm39) probably null Het
Dnhd1 GT GTT 7: 105,352,787 (GRCm39) probably null Het
Dnmbp T A 19: 43,855,127 (GRCm39) K265N probably damaging Het
Dnmbp T A 19: 43,877,806 (GRCm39) T422S probably benign Het
Dnmt1 C A 9: 20,837,850 (GRCm39) V381L probably benign Het
Dnmt1 T G 9: 20,827,159 (GRCm39) K979T probably damaging Het
Dnmt3a G T 12: 3,954,201 (GRCm39) W791L probably damaging Het
Doc2b A T 11: 75,667,898 (GRCm39) L284Q probably benign Het
Dock10 A C 1: 80,538,671 (GRCm39) L959V probably benign Het
Dock11 G T X: 35,248,501 (GRCm39) A699S possibly damaging Het
Dock2 A C 11: 34,609,751 (GRCm39) F230V probably benign Het
Dock4 A T 12: 40,681,613 (GRCm39) Y104F probably benign Het
Dock4 G C 12: 40,681,615 (GRCm39) V105L probably benign Het
Dock7 C A 4: 98,833,462 (GRCm39) G1945V unknown Het
Dock9 C A 14: 121,889,194 (GRCm39) G308C probably benign Het
Dop1b G A 16: 93,604,756 (GRCm39) G2132E possibly damaging Het
Dop1b T A 16: 93,566,469 (GRCm39) S1083R probably benign Het
Dop1b G T 16: 93,600,434 (GRCm39) S2037I probably damaging Het
Dpagt1 G T 9: 44,240,422 (GRCm39) V213L probably benign Het
Dpp10 C A 1: 123,281,169 (GRCm39) E627* probably null Het
Dpp3 T G 19: 4,972,369 (GRCm39) Q185P probably damaging Het
Dpp6 C A 5: 27,603,996 (GRCm39) A142E probably damaging Het
Dpysl5 G T 5: 30,935,464 (GRCm39) R189L probably benign Het
Drd2 G T 9: 49,306,955 (GRCm39) E14* probably null Het
Dsc1 C A 18: 20,247,595 (GRCm39) A7S probably benign Het
Dsc2 A T 18: 20,168,356 (GRCm39) L701Q probably damaging Het
Dsg1c G T 18: 20,416,630 (GRCm39) G844C probably damaging Het
Dsg2 C A 18: 20,713,678 (GRCm39) F216L probably damaging Het
Dsp C G 13: 38,381,166 (GRCm39) T2637R possibly damaging Het
Dtx1 T C 5: 120,821,360 (GRCm39) S396G probably benign Het
Dtx3l G C 16: 35,753,553 (GRCm39) S351C probably damaging Het
Dtx3l C G 16: 35,752,827 (GRCm39) C593S probably damaging Het
Dtx4 C G 19: 12,469,273 (GRCm39) A285P probably benign Het
Duox1 G T 2: 122,163,519 (GRCm39) G784W probably damaging Het
Duox2 T C 2: 122,126,988 (GRCm39) T176A probably damaging Het
Dusp8 C A 7: 141,635,680 (GRCm39) G637W unknown Het
Dusp8 C G 7: 141,643,814 (GRCm39) R33P probably damaging Het
Dvl1 G T 4: 155,940,068 (GRCm39) G400V probably benign Het
Dvl3 G C 16: 20,349,631 (GRCm39) A535P probably damaging Het
Dydc2 C A 14: 40,783,940 (GRCm39) R61L probably benign Het
Dync1i2 G T 2: 71,078,228 (GRCm39) V306L probably benign Het
Dync2h1 G T 9: 7,142,361 (GRCm39) P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 (GRCm39) probably null Het
Dyrk1a A T 16: 94,492,621 (GRCm39) H618L probably benign Het
Dyrk4 T G 6: 126,869,091 (GRCm39) K240N probably damaging Het
Dysf T A 6: 84,049,667 (GRCm39) L372H probably damaging Het
Dzip1l G T 9: 99,523,814 (GRCm39) G205V possibly damaging Het
E030025P04Rik C A 11: 109,034,797 (GRCm39) Q30H unknown Het
E130114P18Rik G T 4: 97,457,437 (GRCm39) P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 (GRCm39) C615F probably damaging Het
E230025N22Rik T A 18: 36,828,877 (GRCm39) probably benign Het
E2f6 A C 12: 16,870,274 (GRCm39) K142T possibly damaging Het
E4f1 G A 17: 24,665,119 (GRCm39) S355L probably benign Het
Ears2 C G 7: 121,643,804 (GRCm39) G385R probably damaging Het
Ears2 C G 7: 121,654,933 (GRCm39) A112P possibly damaging Het
Ebna1bp2 A C 4: 118,478,343 (GRCm39) K44T probably damaging Het
Ece1 T G 4: 137,648,338 (GRCm39) F32V probably benign Het
Ecm1 T C 3: 95,642,188 (GRCm39) I466V probably benign Het
Edil3 G C 13: 89,092,989 (GRCm39) G40R probably benign Het
Eef2 G T 10: 81,016,992 (GRCm39) probably null Het
Efcab3 C A 11: 104,990,872 (GRCm39) A93D probably damaging Het
Efcab3 T G 11: 104,999,598 (GRCm39) Y162* probably null Het
Efcab3 G C 11: 104,892,793 (GRCm39) G4247R probably benign Het
Efcab5 C G 11: 77,022,965 (GRCm39) D583H probably damaging Het
Efcc1 G T 6: 87,709,778 (GRCm39) E257D probably benign Het
Efs C A 14: 55,157,793 (GRCm39) V173L probably benign Het
Egf C A 3: 129,491,366 (GRCm39) probably null Het
Ehbp1 G C 11: 22,045,590 (GRCm39) P720A probably benign Het
Ehbp1l1 T A 19: 5,767,917 (GRCm39) M1129L probably benign Het
Ehd3 C A 17: 74,112,280 (GRCm39) P15T probably benign Het
Ehf C A 2: 103,109,863 (GRCm39) G115C probably null Het
Eif2a G T 3: 58,456,305 (GRCm39) V435L probably benign Het
Eif2d C G 1: 131,092,239 (GRCm39) P337A probably damaging Het
Eif2d A T 1: 131,092,202 (GRCm39) K324N probably damaging Het
Eif3i C A 4: 129,494,368 (GRCm39) probably benign Het
Eif4a3l1 G C 6: 136,306,021 (GRCm39) A161P possibly damaging Het
Eif4e2 G A 1: 87,153,661 (GRCm39) M155I probably benign Het
Eif4g1 G T 16: 20,492,158 (GRCm39) probably benign Het
Eipr1 G T 12: 28,909,286 (GRCm39) Q184H probably benign Het
Elapor1 C A 3: 108,379,294 (GRCm39) G345C probably damaging Het
Elapor1 C A 3: 108,378,751 (GRCm39) W349L probably damaging Het
Ell A C 8: 71,031,577 (GRCm39) S92R probably damaging Het
Ell2 A T 13: 75,918,808 (GRCm39) N605Y probably damaging Het
Ell2 A C 13: 75,904,571 (GRCm39) K220T probably damaging Het
Elmod1 T G 9: 53,854,144 (GRCm39) K2T probably benign Het
Elovl5 G C 9: 77,884,037 (GRCm39) R111P possibly damaging Het
Elp1 T A 4: 56,790,146 (GRCm39) T315S probably benign Het
Eme1 A C 11: 94,541,522 (GRCm39) I100S possibly damaging Het
Eml4 G C 17: 83,753,394 (GRCm39) R355T probably damaging Het
Enam C A 5: 88,640,830 (GRCm39) P164H probably damaging Het
Eng G T 2: 32,563,436 (GRCm39) G331C probably null Het
Eng C G 2: 32,561,434 (GRCm39) I148M possibly damaging Het
Eng G C 2: 32,571,464 (GRCm39) R618P probably damaging Het
Enpp3 T G 10: 24,663,691 (GRCm39) T557P probably benign Het
Entpd1 G T 19: 40,727,408 (GRCm39) A519S probably benign Het
Entpd7 G C 19: 43,713,797 (GRCm39) L385F probably benign Het
Ep400 A C 5: 110,904,501 (GRCm39) L33V unknown Het
Epas1 C T 17: 87,135,374 (GRCm39) S669L possibly damaging Het
Epb41l2 A T 10: 25,375,800 (GRCm39) R80* probably null Het
Epb41l2 G T 10: 25,317,618 (GRCm39) G45V probably benign Het
Epc2 G T 2: 49,425,312 (GRCm39) G396C probably damaging Het
Epha10 G C 4: 124,779,568 (GRCm39) G138A probably damaging Het
Epha10 T C 4: 124,777,735 (GRCm39) W50R probably damaging Het
Epha3 G T 16: 63,405,375 (GRCm39) P695Q probably damaging Het
Epha4 T G 1: 77,359,648 (GRCm39) K735T probably damaging Het
Epha4 T C 1: 77,350,370 (GRCm39) *987W probably null Het
Epha5 C T 5: 84,218,979 (GRCm39) D765N possibly damaging Het
Epha8 C A 4: 136,666,007 (GRCm39) R383L probably benign Het
Ephb1 G A 9: 102,100,597 (GRCm39) P38L probably damaging Het
Ephb3 G T 16: 21,036,786 (GRCm39) G337V possibly damaging Het
Ephx3 T G 17: 32,404,211 (GRCm39) N343T probably damaging Het
Epop C A 11: 97,519,236 (GRCm39) R291L probably damaging Het
Eral1 T G 11: 77,966,446 (GRCm39) K244T probably damaging Het
Erap1 T A 13: 74,805,757 (GRCm39) L166H probably damaging Het
Erbb4 CA CAA 1: 68,337,561 (GRCm39) probably null Het
Erbb4 G T 1: 68,367,418 (GRCm39) S433* probably null Het
Ercc2 A C 7: 19,119,593 (GRCm39) S136R probably benign Het
Ercc6 A T 14: 32,248,444 (GRCm39) S332C probably benign Het
Ereg G T 5: 91,237,979 (GRCm39) G155V possibly damaging Het
Erg T G 16: 95,162,176 (GRCm39) Q317P probably damaging Het
Erg T G 16: 95,210,609 (GRCm39) Q81P possibly damaging Het
Erh C A 12: 80,689,578 (GRCm39) L15F probably benign Het
Erich2 C A 2: 70,339,458 (GRCm39) D4E possibly damaging Het
Erich3 G T 3: 154,468,067 (GRCm39) V840L Het
Erich3 T G 3: 154,404,338 (GRCm39) I65S Het
Ero1a G A 14: 45,537,347 (GRCm39) P193L probably damaging Het
Esp18 C T 17: 39,719,057 (GRCm39) L19F probably damaging Het
Esrp1 C T 4: 11,384,396 (GRCm39) G96R probably damaging Het
Esrp1 A T 4: 11,385,765 (GRCm39) L34Q possibly damaging Het
Ess2 C T 16: 17,720,174 (GRCm39) G393S possibly damaging Het
Etv4 C T 11: 101,661,416 (GRCm39) V412M probably damaging Het
Exoc3l G T 8: 106,017,426 (GRCm39) S546Y possibly damaging Het
Exoc3l2 C A 7: 19,213,986 (GRCm39) L471M probably null Het
Exoc3l4 G T 12: 111,390,154 (GRCm39) W243L probably damaging Het
Exoc8 C T 8: 125,623,405 (GRCm39) V321I possibly damaging Het
Eya1 G C 1: 14,322,654 (GRCm39) A270G probably benign Het
Eya1 G T 1: 14,373,092 (GRCm39) P9Q probably damaging Het
Ezhip G T X: 5,994,368 (GRCm39) P216T unknown Het
Ezhip T G X: 5,994,375 (GRCm39) E213D unknown Het
F5 C G 1: 164,012,085 (GRCm39) F434L probably damaging Het
F830045P16Rik G T 2: 129,378,450 (GRCm39) probably benign Het
Fabp1 A T 6: 71,176,939 (GRCm39) Q10L possibly damaging Het
Fads1 T A 19: 10,171,068 (GRCm39) L299M probably damaging Het
Fads2b C T 2: 85,348,806 (GRCm39) R102Q probably benign Het
Fads3 A T 19: 10,019,171 (GRCm39) I26F probably benign Het
Faf1 A G 4: 109,697,553 (GRCm39) D293G probably damaging Het
Fam124a T C 14: 62,843,857 (GRCm39) M455T probably benign Het
Fam124b A C 1: 80,191,120 (GRCm39) F88V possibly damaging Het
Fam149a C A 8: 45,795,495 (GRCm39) R672L possibly damaging Het
Fam161b G T 12: 84,402,827 (GRCm39) Q268K probably benign Het
Fam170a C A 18: 50,414,651 (GRCm39) A99D possibly damaging Het
Fam170b A C 14: 32,557,761 (GRCm39) N199H probably damaging Het
Fam171a2 C G 11: 102,338,272 (GRCm39) A24P unknown Het
Fam236f G A X: 101,750,633 (GRCm39) T72M probably benign Het
Fam240a T G 9: 110,745,577 (GRCm39) K29T probably damaging Het
Fam3b C A 16: 97,283,044 (GRCm39) R77L probably damaging Het
Fam47e G T 5: 92,727,527 (GRCm39) R145L possibly damaging Het
Fam83g C A 11: 61,598,296 (GRCm39) P728T probably benign Het
Fance T G 17: 28,537,038 (GRCm39) L14R probably damaging Het
Fancm A C 12: 65,141,700 (GRCm39) E440D probably benign Het
Fap C A 2: 62,359,118 (GRCm39) S428I possibly damaging Het
Farp2 G T 1: 93,508,189 (GRCm39) G629V probably benign Het
Farp2 G C 1: 93,508,183 (GRCm39) G627A probably benign Het
Farp2 T C 1: 93,507,858 (GRCm39) F519L probably benign Het
Fat1 A C 8: 45,476,633 (GRCm39) H1893P possibly damaging Het
Fat1 G A 8: 45,403,635 (GRCm39) D129N probably benign Het
Fat1 G T 8: 45,489,875 (GRCm39) D3596Y probably damaging Het
Fat2 T G 11: 55,194,526 (GRCm39) K1171T probably damaging Het
Fat2 G T 11: 55,175,817 (GRCm39) A1632E probably damaging Het
Fat2 A G 11: 55,173,621 (GRCm39) L2364P probably damaging Het
Fat2 T G 11: 55,200,947 (GRCm39) H709P probably damaging Het
Fat3 G T 9: 15,858,822 (GRCm39) P3798Q probably damaging Het
Fat3 T G 9: 16,286,913 (GRCm39) H870P probably benign Het
Fat3 G T 9: 16,286,725 (GRCm39) P933T probably damaging Het
Fat4 G T 3: 39,037,508 (GRCm39) G3720V probably benign Het
Fat4 C G 3: 39,037,964 (GRCm39) P3872R probably damaging Het
Fblim1 C T 4: 141,322,682 (GRCm39) A34T possibly damaging Het
Fbn1 C T 2: 125,229,270 (GRCm39) G504S possibly damaging Het
Fbxl16 G C 17: 26,035,985 (GRCm39) G194A possibly damaging Het
Fbxl18 T G 5: 142,872,179 (GRCm39) K352T possibly damaging Het
Fbxl19 CT C 7: 127,360,447 (GRCm39) probably null Het
Fbxl21 C A 13: 56,674,816 (GRCm39) L56I probably benign Het
Fbxl22 G T 9: 66,419,170 (GRCm39) R156S probably benign Het
Fbxl4 T C 4: 22,427,280 (GRCm39) L507P probably damaging Het
Fbxo17 G C 7: 28,432,202 (GRCm39) G93A unknown Het
Fbxo24 T G 5: 137,619,665 (GRCm39) K187T probably damaging Het
Fbxo28 T A 1: 182,145,435 (GRCm39) I218F probably damaging Het
Fbxo30 A T 10: 11,171,064 (GRCm39) E714V probably damaging Het
Fbxo32 C A 15: 58,068,638 (GRCm39) D115Y probably damaging Het
Fbxo40 T A 16: 36,789,961 (GRCm39) D383V probably damaging Het
Fbxo42 T G 4: 140,907,845 (GRCm39) probably null Het
Fbxw19 T C 9: 109,310,650 (GRCm39) K424R probably benign Het
Fbxw21 T C 9: 108,974,605 (GRCm39) H305R probably benign Het
Fbxw25 C A 9: 109,480,806 (GRCm39) W291C Het
Fcgbpl1 G A 7: 27,841,811 (GRCm39) S582N probably benign Het
Fcgbpl1 G A 7: 27,854,187 (GRCm39) G1717D probably benign Het
Fdx2 C A 9: 20,984,788 (GRCm39) M5I probably benign Het
Fer1l5 C A 1: 36,429,644 (GRCm39) Y465* probably null Het
Fermt1 G T 2: 132,777,938 (GRCm39) P177Q probably benign Het
Fermt1 C G 2: 132,748,676 (GRCm39) G649A probably damaging Het
Fermt1 G T 2: 132,783,863 (GRCm39) Q49K probably benign Het
Ffar3 A T 7: 30,554,618 (GRCm39) F234Y probably damaging Het
Fgd3 C A 13: 49,435,302 (GRCm39) D319Y probably damaging Het
Fgd5 A C 6: 91,965,870 (GRCm39) K701T probably damaging Het
Fgr C A 4: 132,727,481 (GRCm39) H461N probably benign Het
Fhip1a G T 3: 85,580,508 (GRCm39) L566I probably benign Het
Fhip2b G T 14: 70,823,644 (GRCm39) S575R not run Het
Fibcd1 G A 2: 31,728,551 (GRCm39) T102I probably benign Het
Flg A C 3: 93,187,269 (GRCm39) R240S probably benign Het
Flii C A 11: 60,613,139 (GRCm39) G221C possibly damaging Het
Flnb T G 14: 7,942,066 (GRCm38) I2348S probably benign Het
Flot1 A C 17: 36,136,715 (GRCm39) K219T probably damaging Het
Flrt2 G T 12: 95,745,686 (GRCm39) W8L possibly damaging Het
Flrt2 G T 12: 95,746,333 (GRCm39) G224C probably damaging Het
Flywch1 A C 17: 23,979,983 (GRCm39) W264G probably benign Het
Fmn2 G T 1: 174,435,960 (GRCm39) V644L unknown Het
Fmo2 C A 1: 162,725,843 (GRCm39) G11V probably damaging Het
Fmo2 G T 1: 162,715,167 (GRCm39) Q152K probably benign Het
Fmo6 G C 1: 162,753,701 (GRCm39) S147* probably null Het
Fmod T G 1: 133,968,657 (GRCm39) Y232* probably null Het
Fn1 C G 1: 71,636,570 (GRCm39) G2194A probably benign Het
Fndc1 C A 17: 7,992,425 (GRCm39) G424* probably null Het
Fndc1 T G 17: 8,023,709 (GRCm39) K82T possibly damaging Het
Fndc3a C A 14: 72,804,813 (GRCm39) K489N probably damaging Het
Fndc3c1 G T X: 105,477,935 (GRCm39) P767T not run Het
Foxd1 G C 13: 98,492,446 (GRCm39) G440A unknown Het
Foxd3 C A 4: 99,545,303 (GRCm39) P148T probably damaging Het
Foxf1 G T 8: 121,811,268 (GRCm39) R44L probably damaging Het
Foxi1 G T 11: 34,157,488 (GRCm39) P179H probably damaging Het
Foxi3 G A 6: 70,933,782 (GRCm39) A90T probably benign Het
Foxj2 A T 6: 122,809,895 (GRCm39) probably null Het
Foxj2 G T 6: 122,810,670 (GRCm39) A217S probably benign Het
Foxo3 T TG 10: 42,151,261 (GRCm39) probably null Het
Fpgs C T 2: 32,582,672 (GRCm39) R67H probably benign Het
Fpr3 C A 17: 18,191,255 (GRCm39) H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,333,655 (GRCm39) W278C probably benign Het
Fras1 T C 5: 96,906,001 (GRCm39) L3135P probably benign Het
Frem1 C A 4: 82,918,220 (GRCm39) G574V probably damaging Het
Frem3 C A 8: 81,338,132 (GRCm39) R142S probably damaging Het
Frem3 T C 8: 81,342,060 (GRCm39) L1451P probably benign Het
Frg1 T A 8: 41,852,675 (GRCm39) R186* probably null Het
Frmd4a A G 2: 4,502,832 (GRCm39) D107G probably damaging Het
Frmpd3 G T X: 139,333,759 (GRCm39) E1575* probably null Het
Fryl T C 5: 73,230,180 (GRCm39) D1659G probably benign Het
Fscb T G 12: 64,519,704 (GRCm39) E587D unknown Het
Fsd2 T C 7: 81,202,940 (GRCm39) E213G probably damaging Het
Fshr C G 17: 89,354,095 (GRCm39) A88P probably benign Het
Fsip1 G T 2: 117,966,964 (GRCm39) L454I possibly damaging Het
Fsip2 G T 2: 82,820,009 (GRCm39) M5247I probably benign Het
Fstl3 G C 10: 79,617,032 (GRCm39) V192L probably benign Het
Fstl5 A T 3: 76,615,289 (GRCm39) K783N probably damaging Het
Fubp1 G A 3: 151,927,724 (GRCm39) G391D probably damaging Het
Fxn C G 19: 24,239,406 (GRCm39) R162P probably damaging Het
Fyb2 G C 4: 104,770,857 (GRCm39) Q57H probably damaging Het
Gabpb2 G T 3: 95,098,004 (GRCm39) T223N probably benign Het
Gabra3 C T X: 71,488,959 (GRCm39) S322N probably damaging Het
Gabra4 G T 5: 71,781,238 (GRCm39) A391D probably benign Het
Gabrp T C 11: 33,502,673 (GRCm39) E397G probably benign Het
Gabrr3 C A 16: 59,227,845 (GRCm39) S34* probably null Het
Gadd45a C A 6: 67,013,720 (GRCm39) G109V probably benign Het
Gal3st2b T G 1: 93,866,407 (GRCm39) L36R probably damaging Het
Galm C G 17: 80,490,662 (GRCm39) T273S possibly damaging Het
Galnt9 CG C 5: 110,744,012 (GRCm39) probably null Het
Galntl5 C A 5: 25,408,187 (GRCm39) P220T probably damaging Het
Galntl6 A C 8: 58,310,592 (GRCm39) Y370D probably damaging Het
Garem1 T G 18: 21,262,849 (GRCm39) K655T probably damaging Het
Garem1 G A 18: 21,281,382 (GRCm39) H325Y probably damaging Het
Garin4 C T 1: 190,895,942 (GRCm39) V234I probably benign Het
Gatad2a T A 8: 70,388,688 (GRCm39) probably null Het
Gba1 A T 3: 89,111,312 (GRCm39) K26* probably null Het
Gbp3 G A 3: 142,267,624 (GRCm39) V34M probably damaging Het
Gck C A 11: 5,856,526 (GRCm39) M210I probably damaging Het
Gckr G T 5: 31,458,175 (GRCm39) R172I probably damaging Het
Gdap1l1 G T 2: 163,289,590 (GRCm39) R185L probably damaging Het
Gdf10 C T 14: 33,654,489 (GRCm39) T332M possibly damaging Het
Gdf15 T C 8: 71,082,540 (GRCm39) S189G probably benign Het
Gdf7 C T 12: 8,348,409 (GRCm39) R304H unknown Het
Gdf7 G T 12: 8,348,578 (GRCm39) P240T unknown Het
Gdf9 C A 11: 53,328,352 (GRCm39) T436K probably damaging Het
Gemin4 G T 11: 76,108,405 (GRCm39) probably benign Het
Gga3 T G 11: 115,478,429 (GRCm39) Q454H probably benign Het
Ggt5 A G 10: 75,438,452 (GRCm39) probably null Het
Ggt7 T A 2: 155,340,983 (GRCm39) N394I probably damaging Het
Ggt7 T A 2: 155,332,998 (GRCm39) R622W probably damaging Het
Gh G C 11: 106,192,010 (GRCm39) R67G probably damaging Het
Ghdc A G 11: 100,660,243 (GRCm39) L168P probably benign Het
Ghr A G 15: 3,376,967 (GRCm39) Y85H probably benign Het
Gimap1 A C 6: 48,720,183 (GRCm39) K265T probably damaging Het
Gimap1 T G 6: 48,720,290 (GRCm39) *301E probably null Het
Gimap7 C A 6: 48,701,087 (GRCm39) D224E probably benign Het
Gins3 G T 8: 96,360,148 (GRCm39) probably benign Het
Gjd3 C A 11: 102,690,834 (GRCm39) G390W unknown Het
Glcci1 A T 6: 8,582,674 (GRCm39) Q345L possibly damaging Het
Glipr1 G T 10: 111,824,742 (GRCm39) P155T probably benign Het
Glis3 G C 19: 28,261,168 (GRCm39) P791R possibly damaging Het
Glra3 G T 8: 56,515,535 (GRCm39) M203I probably benign Het
Gls C G 1: 52,253,647 (GRCm39) D274H probably damaging Het
Gm10300 C G 4: 131,802,120 (GRCm39) P38R unknown Het
Gm10340 A G 14: 14,826,710 (GRCm39) R60G possibly damaging Het
Gm10803 G C 2: 93,394,481 (GRCm39) Q84H unknown Het
Gm11565 C T 11: 99,805,677 (GRCm39) S23F possibly damaging Het
Gm11567 G A 11: 99,770,158 (GRCm39) S32N unknown Het
Gm11567 C A 11: 99,770,451 (GRCm39) Q130K unknown Het
Gm11567 C A 11: 99,770,247 (GRCm39) Q62K unknown Het
Gm11983 T C 11: 6,787,047 (GRCm39) K27E unknown Het
Gm11983 T G 11: 6,786,861 (GRCm39) K89Q unknown Het
Gm12185 T G 11: 48,798,913 (GRCm39) I527L probably benign Het
Gm12888 G T 4: 121,182,005 (GRCm39) P29H probably damaging Het
Gm15130 A G 2: 110,974,932 (GRCm39) probably null Het
Gm16503 A C 4: 147,625,613 (GRCm39) T36P unknown Het
Gm17019 C T 5: 15,083,011 (GRCm39) probably benign Het
Gm17124 A G 14: 42,419,180 (GRCm39) probably null Het
Gm19410 G T 8: 36,259,765 (GRCm39) W800L possibly damaging Het
Gm21083 T G 5: 15,782,456 (GRCm39) V41G probably benign Het
Gm21149 G C 5: 15,681,410 (GRCm39) R18G not run Het
Gm21149 G T 5: 15,677,146 (GRCm39) A236D probably damaging Het
Gm21190 G A 5: 15,729,892 (GRCm39) P242L probably benign Het
Gm21190 A C 5: 15,729,972 (GRCm39) D215E not run Het
Gm21190 G T 5: 15,731,578 (GRCm39) T136N probably benign Het
Gm21680 C T 5: 26,176,417 (GRCm39) S60N probably benign Het
Gm21886 G T 18: 80,133,138 (GRCm39) L14M probably damaging Het
Gm21886 G C 18: 80,132,602 (GRCm39) Y185* probably null Het
Gm28729 C T 9: 96,374,141 (GRCm39) R401H unknown Het
Gm29609 A T 5: 31,311,586 (GRCm39) W852R probably benign Het
Gm29797 G C 2: 181,300,888 (GRCm39) A128P probably damaging Het
Gm3238 G T 10: 77,606,858 (GRCm39) P101Q unknown Het
Gm32742 G A 9: 51,070,465 (GRCm39) Q76* probably null Het
Gm3285 G A 10: 77,698,268 (GRCm39) C139Y unknown Het
Gm3543 T G 14: 41,802,964 (GRCm39) N60T probably damaging Het
Gm45618 T C 7: 141,673,955 (GRCm39) K171R unknown Het
Gm45861 G A 8: 28,074,897 (GRCm39) G1416S unknown Het
Gm4779 G T X: 100,835,792 (GRCm39) P504H unknown Het
Gm47985 T C 1: 151,058,892 (GRCm39) S178P possibly damaging Het
Gm49336 C A 14: 60,476,951 (GRCm39) C240F probably null Het
Gm5111 C A 6: 48,567,243 (GRCm39) L153M unknown Het
Gm5592 C A 7: 40,938,105 (GRCm39) D462E probably benign Het
Gm5592 G A 7: 40,935,743 (GRCm39) E82K possibly damaging Het
Gm5592 C G 7: 40,935,741 (GRCm39) T81R probably damaging Het
Gm57858 T C 3: 36,073,037 (GRCm39) Q415R possibly damaging Het
Gm5862 TGGG TGG 5: 26,223,485 (GRCm39) probably null Het
Gm6377 T G X: 108,241,899 (GRCm39) L160R probably damaging Het
Gm6871 C A 7: 41,195,837 (GRCm39) G300V probably damaging Het
Gm7138 C G 10: 77,612,687 (GRCm39) C31S unknown Het
Gm7145 A C 1: 117,914,081 (GRCm39) K321T probably benign Het
Gm7298 G T 6: 121,741,834 (GRCm39) D419Y possibly damaging Het
Gm7298 A C 6: 121,741,829 (GRCm39) E417A probably benign Het
Gm7579 G T 7: 141,765,678 (GRCm39) G28V unknown Het
Gm8369 G C 19: 11,488,988 (GRCm39) A92P probably damaging Het
Gm973 T G 1: 59,563,761 (GRCm39) probably benign Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9887 C A 12: 69,418,715 (GRCm39) W173L not run Het
Gm9964 T C 11: 79,187,226 (GRCm39) R74G unknown Het
Gmip C T 8: 70,268,942 (GRCm39) R496W probably damaging Het
Gmpr2 T G 14: 55,910,200 (GRCm39) L10R probably benign Het
Gna12 C A 5: 140,748,362 (GRCm39) D185Y probably damaging Het
Gna12 T A 5: 140,746,308 (GRCm39) Q379L probably damaging Het
Gnas C A 2: 174,140,399 (GRCm39) P249T unknown Het
Gnptab G T 10: 88,267,230 (GRCm39) E440D probably damaging Het
Gpa33 C A 1: 165,992,240 (GRCm39) C261* probably null Het
Gpat2 G C 2: 127,275,728 (GRCm39) G502A probably damaging Het
Gpat2 C A 2: 127,272,802 (GRCm39) F171L probably benign Het
Gpat4 C G 8: 23,669,814 (GRCm39) S313T probably benign Het
Gpatch1 C A 7: 35,009,910 (GRCm39) G55C probably damaging Het
Gpc5 T A 14: 115,607,376 (GRCm39) L326Q probably damaging Het
Gpd1l C A 9: 114,733,848 (GRCm39) G283W probably damaging Het
Gpnmb C A 6: 49,028,766 (GRCm39) A428D possibly damaging Het
Gpr101 T G X: 56,546,634 (GRCm39) H172P probably benign Het
Gpr158 G T 2: 21,815,501 (GRCm39) probably null Het
Gpr179 G C 11: 97,227,474 (GRCm39) S1560R probably benign Het
Gpr26 C G 7: 131,568,954 (GRCm39) L100V probably damaging Het
Gpr26 C A 7: 131,568,777 (GRCm39) P41T probably damaging Het
Gpr39 G T 1: 125,800,580 (GRCm39) G444W probably damaging Het
Gprasp2 G T X: 134,743,642 (GRCm39) G334W probably damaging Het
Gprin1 C A 13: 54,888,210 (GRCm39) Q21H probably benign Het
Gpsm1 G T 2: 26,217,357 (GRCm39) Q408H possibly damaging Het
Grb10 C A 11: 11,894,845 (GRCm39) A359S possibly damaging Het
Grb7 G C 11: 98,345,310 (GRCm39) G456R probably damaging Het
Grb7 G T 11: 98,344,797 (GRCm39) probably null Het
Greb1 C A 12: 16,746,757 (GRCm39) C1171F probably benign Het
Greb1l G C 18: 10,515,305 (GRCm39) G699A probably damaging Het
Grep1 G C 17: 23,934,737 (GRCm39) A96G possibly damaging Het
Gria3 C A X: 40,567,524 (GRCm39) A113D probably benign Het
Grid2 G A 6: 63,885,863 (GRCm39) M86I possibly damaging Het
Grid2 A G 6: 64,640,212 (GRCm39) Q810R probably benign Het
Grik5 T A 7: 24,713,229 (GRCm39) D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,187,919 (GRCm39) probably null Het
Grin3a A G 4: 49,770,622 (GRCm39) S717P probably damaging Het
Grip1 C A 10: 119,655,388 (GRCm39) probably benign Het
Grip2 G C 6: 91,740,491 (GRCm39) P1023A possibly damaging Het
Grk2 C G 19: 4,337,673 (GRCm39) M568I probably benign Het
Grk3 C A 5: 113,105,180 (GRCm39) probably null Het
Grm5 G T 7: 87,251,923 (GRCm39) G58W probably damaging Het
Grm6 C A 11: 50,750,364 (GRCm39) P509H probably benign Het
Grm7 A G 6: 111,335,110 (GRCm39) E507G probably benign Het
Grm7 G T 6: 111,335,451 (GRCm39) V621F probably damaging Het
Grm8 G C 6: 28,126,026 (GRCm39) S33R probably benign Het
Grpr A G X: 162,298,030 (GRCm39) L338P probably damaging Het
Grtp1 T G 8: 13,250,199 (GRCm39) I17L probably benign Het
Gsdma C A 11: 98,560,585 (GRCm39) P179H probably damaging Het
Gsk3b A T 16: 38,028,432 (GRCm39) K297* probably null Het
Gspt2 GC G X: 93,681,074 (GRCm39) probably null Het
Gsta13 T A 9: 78,166,045 (GRCm39) C18S probably benign Het
Gtf2h3 G T 5: 124,717,238 (GRCm39) probably benign Het
Gtf2i C A 5: 134,292,499 (GRCm39) G415V probably null Het
Gtf2ird1 T G 5: 134,438,166 (GRCm39) probably null Het
Gtf3a G A 5: 146,888,014 (GRCm39) C105Y probably damaging Het
Gtf3c1 T A 7: 125,303,136 (GRCm39) I100F probably damaging Het
Gtse1 A G 15: 85,752,947 (GRCm39) K354R possibly damaging Het
Guca1a T C 17: 47,711,335 (GRCm39) I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 (GRCm39) K400T probably damaging Het
Gulp1 C A 1: 44,827,639 (GRCm39) D260E probably damaging Het
Gxylt2 T G 6: 100,760,152 (GRCm39) L229R probably damaging Het
Gykl1 A G 18: 52,827,619 (GRCm39) K276E probably damaging Het
H1f5 T C 13: 21,964,264 (GRCm39) K154R unknown Het
H2ac21 G T 3: 96,127,367 (GRCm39) A46S probably benign Het
H2-Eb2 A C 17: 34,553,283 (GRCm39) E156D possibly damaging Het
H2-M11 A C 17: 36,859,662 (GRCm39) R218S possibly damaging Het
H2-Q2 A C 17: 35,564,651 (GRCm39) Q351P probably damaging Het
H2-T3 C G 17: 36,497,472 (GRCm39) L382F possibly damaging Het
H2-T3 A T 17: 36,497,474 (GRCm39) L382M possibly damaging Het
H4c9 C A 13: 22,225,384 (GRCm39) R37L probably damaging Het
Habp2 T C 19: 56,306,192 (GRCm39) V426A probably damaging Het
Hacd1 C A 2: 14,040,606 (GRCm39) M216I probably damaging Het
Hacd2 G T 16: 34,926,695 (GRCm39) Q231H probably damaging Het
Hace1 A T 10: 45,562,758 (GRCm39) N758Y probably damaging Het
Hal G A 10: 93,325,755 (GRCm39) M89I probably benign Het
Hbb-bt A G 7: 103,463,099 (GRCm39) probably benign Het
Hc T A 2: 34,896,285 (GRCm39) probably null Het
Hcar1 T A 5: 124,017,804 (GRCm39) probably benign Het
Hcfc2 G C 10: 82,535,006 (GRCm39) R10T probably damaging Het
Hcls1 G T 16: 36,781,854 (GRCm39) R321M possibly damaging Het
Hcn4 G T 9: 58,765,431 (GRCm39) G638C unknown Het
Hdac1 T A 4: 129,436,409 (GRCm39) Q5L probably benign Het
Hdac9 G T 12: 34,423,986 (GRCm39) T536K probably benign Het
Hdgfl2 G T 17: 56,386,825 (GRCm39) R24L possibly damaging Het
Hdgfl2 G T 17: 56,404,016 (GRCm39) A281S probably null Het
Heatr1 T G 13: 12,413,889 (GRCm39) N155K possibly damaging Het
Hecw1 G A 13: 14,474,918 (GRCm39) A540V possibly damaging Het
Hells G T 19: 38,953,851 (GRCm39) R765S possibly damaging Het
Helq C A 5: 100,914,632 (GRCm39) L953F possibly damaging Het
Helz2 G C 2: 180,879,357 (GRCm39) P754A probably benign Het
Heph G C X: 95,598,528 (GRCm39) E919Q probably damaging Het
Herc1 A C 9: 66,341,858 (GRCm39) E1882D probably benign Het
Herc2 G A 7: 55,781,040 (GRCm39) G1235D probably benign Het
Herc2 G A 7: 55,747,281 (GRCm39) V473I possibly damaging Het
Herc2 G T 7: 55,782,246 (GRCm39) G1311V probably damaging Het
Herc3 G T 6: 58,820,843 (GRCm39) E76* probably null Het
Herc4 T G 10: 63,143,528 (GRCm39) I686S probably benign Het
Herc6 G T 6: 57,577,016 (GRCm39) G243V probably damaging Het
Herpud2 C G 9: 25,041,918 (GRCm39) V85L not run Het
Hexd C A 11: 121,106,063 (GRCm39) P117T probably damaging Het
Hip1r A G 5: 124,135,073 (GRCm39) Q403R probably damaging Het
Hivep3 C T 4: 119,990,979 (GRCm39) R2160W probably damaging Het
Hlcs A C 16: 94,063,518 (GRCm39) L367R probably damaging Het
Hmcn1 A G 1: 150,539,668 (GRCm39) V2941A probably benign Het
Hmcn1 G T 1: 150,462,196 (GRCm39) Q5161K probably null Het
Hmcn1 A G 1: 150,531,672 (GRCm39) V3199A possibly damaging Het
Hmcn2 C A 2: 31,315,428 (GRCm39) L3726M probably damaging Het
Hmcn2 G T 2: 31,319,103 (GRCm39) R3934S probably damaging Het
Hmcn2 G C 2: 31,234,041 (GRCm39) D269H possibly damaging Het
Hmga2 G C 10: 120,206,576 (GRCm39) P113A unknown Het
Hmgcs2 G A 3: 98,198,261 (GRCm39) G55S probably damaging Het
Hmx2 A T 7: 131,156,196 (GRCm39) E54V probably damaging Het
Hnf1a CA C 5: 115,088,183 (GRCm39) probably null Het
Hnrnpa2b1 G T 6: 51,444,223 (GRCm39) T20N probably damaging Het
Hnrnpf G A 6: 117,900,745 (GRCm39) G10S probably benign Het
Hnrnph2 G T X: 133,505,882 (GRCm39) E76* probably null Het
Hnrnpu T G 1: 178,159,780 (GRCm39) N434H unknown Het
Hnrnpul1 C A 7: 25,424,089 (GRCm39) S721I probably benign Het
Hnrnpul1 G C 7: 25,424,123 (GRCm39) P710A unknown Het
Hoxb1 C A 11: 96,257,877 (GRCm39) P269Q probably benign Het
Hoxd9 G C 2: 74,528,472 (GRCm39) A25P probably damaging Het
Hp1bp3 C T 4: 137,948,984 (GRCm39) L16F not run Het
Hpd C A 5: 123,319,538 (GRCm39) G49V probably damaging Het
Hps1 C A 19: 42,755,125 (GRCm39) R272S probably null Het
Hsd17b13 G T 5: 104,116,571 (GRCm39) P184T probably benign Het
Hsd17b3 C T 13: 64,210,952 (GRCm39) G182S possibly damaging Het
Hsd3b1 T G 3: 98,760,202 (GRCm39) Q263P probably damaging Het
Hsd3b2 C T 3: 98,619,538 (GRCm39) E136K probably benign Het
Hsd3b3 A G 3: 98,651,276 (GRCm39) V58A probably benign Het
Hsd3b9 G T 3: 98,363,771 (GRCm39) Q25K probably benign Het
Hsdl2 A T 4: 59,617,706 (GRCm39) K478* probably null Het
Hspa1l G C 17: 35,197,468 (GRCm39) K502N possibly damaging Het
Htr1f G T 16: 64,746,440 (GRCm39) S284* probably null Het
Htr1f G T 16: 64,747,237 (GRCm39) N18K probably benign Het
Htr7 G T 19: 35,946,823 (GRCm39) T397N probably damaging Het
Htra2 C A 6: 83,031,364 (GRCm39) R15L probably benign Het
Hunk C A 16: 90,269,461 (GRCm39) P335H probably damaging Het
Huwe1 A C X: 150,711,377 (GRCm39) K3958T unknown Het
Huwe1 C A X: 150,639,571 (GRCm39) H356N probably damaging Het
Hyal4 G A 6: 24,756,627 (GRCm39) V282M probably damaging Het
Hydin T G 8: 111,268,232 (GRCm39) F2904V possibly damaging Het
Hyou1 G T 9: 44,299,039 (GRCm39) E621* probably null Het
Ice1 C A 13: 70,753,320 (GRCm39) C922F probably damaging Het
Ide C T 19: 37,292,890 (GRCm39) V238M Het
Idh3b T A 2: 130,123,462 (GRCm39) probably null Het
Ifi204 C A 1: 173,579,194 (GRCm39) K550N probably null Het
Ifi206 T G 1: 173,309,614 (GRCm39) K127N Het
Ifi27l2b C A 12: 103,423,292 (GRCm39) G7C unknown Het
Ifi44 A G 3: 151,438,090 (GRCm39) L399P probably damaging Het
Ifih1 T G 2: 62,447,813 (GRCm39) Q297P probably benign Het
Ifitm1 C A 7: 140,549,430 (GRCm39) T71K probably benign Het
Ifna5 C T 4: 88,754,236 (GRCm39) H159Y probably damaging Het
Ifnab T G 4: 88,608,955 (GRCm39) E170D probably damaging Het
Ift122 A C 6: 115,892,955 (GRCm39) D854A probably damaging Het
Ift172 C A 5: 31,434,268 (GRCm39) W490L probably damaging Het
Igfbp4 C G 11: 98,942,341 (GRCm39) P234R probably damaging Het
Igfn1 G T 1: 135,899,738 (GRCm39) H524Q probably damaging Het
Ighv1-12 C A 12: 114,579,633 (GRCm39) G63V possibly damaging Het
Ighv14-4 C G 12: 114,140,292 (GRCm39) L39F probably damaging Het
Ighv14-4 C A 12: 114,140,287 (GRCm39) C41F probably damaging Het
Ighv1-52 C A 12: 115,109,397 (GRCm39) V21F probably damaging Het
Ighv1-63 C T 12: 115,459,265 (GRCm39) A111T possibly damaging Het
Ighv1-69 A C 12: 115,586,873 (GRCm39) S87A probably benign Het
Ighv1-9 T G 12: 114,547,454 (GRCm39) E29A probably benign Het
Igkv1-35 C T 6: 69,988,018 (GRCm39) G93R possibly damaging Het
Igkv1-99 T A 6: 68,519,246 (GRCm39) S68T Het
Igkv3-12 A T 6: 70,495,595 (GRCm39) I41F probably benign Het
Igkv4-74 T C 6: 69,162,329 (GRCm39) Q6R possibly damaging Het
Igkv6-32 T A 6: 70,051,570 (GRCm39) probably benign Het
Igsf21 A T 4: 139,794,526 (GRCm39) C116S probably damaging Het
Igsf5 C G 16: 96,192,223 (GRCm39) S274C probably damaging Het
Igsf8 G T 1: 172,145,921 (GRCm39) A406S probably damaging Het
Igsf9 G C 1: 172,319,716 (GRCm39) G337A probably damaging Het
Igsf9 G T 1: 172,322,793 (GRCm39) A586S probably benign Het
Igsf9b A G 9: 27,228,649 (GRCm39) probably null Het
Ihh T G 1: 74,985,253 (GRCm39) S411R probably damaging Het
Ik G T 18: 36,886,568 (GRCm39) D347Y possibly damaging Het
Ikzf1 G T 11: 11,708,194 (GRCm39) probably null Het
Ikzf3 T G 11: 98,358,007 (GRCm39) E443D probably benign Het
Ikzf4 G A 10: 128,470,099 (GRCm39) P527S possibly damaging Het
Il10ra A C 9: 45,177,930 (GRCm39) S67A possibly damaging Het
Il16 C G 7: 83,302,035 (GRCm39) S727T probably benign Het
Il17rc G T 6: 113,453,756 (GRCm39) probably null Het
Il1rap G T 16: 26,541,149 (GRCm39) R463S probably damaging Het
Il27ra C A 8: 84,767,619 (GRCm39) W101C probably damaging Het
Il2ra C A 2: 11,686,742 (GRCm39) A191D probably damaging Het
Il6st A G 13: 112,630,152 (GRCm39) K333E probably benign Het
Impg1 C G 9: 80,285,749 (GRCm39) R418S probably benign Het
Inava C A 1: 136,147,521 (GRCm39) R399L possibly damaging Het
Incenp C A 19: 9,855,051 (GRCm39) W620L unknown Het
Inhbb C A 1: 119,345,528 (GRCm39) V254L probably benign Het
Inpp4b C G 8: 82,795,630 (GRCm39) A818G possibly damaging Het
Inpp5b CA C 4: 124,691,633 (GRCm39) probably null Het
Inpp5d T G 1: 87,597,431 (GRCm39) F201V probably benign Het
Inpp5d T G 1: 87,630,853 (GRCm39) L671W probably damaging Het
Inpp5j G T 11: 3,452,484 (GRCm39) Y255* probably null Het
Insc C T 7: 114,410,874 (GRCm39) Q244* probably null Het
Insm1 C T 2: 146,065,476 (GRCm39) Q431* probably null Het
Insyn2a G T 7: 134,520,435 (GRCm39) L32I probably damaging Het
Ints12 A C 3: 132,808,225 (GRCm39) D201A probably damaging Het
Ints6l G A X: 55,543,295 (GRCm39) M527I probably damaging Het
Ints9 G A 14: 65,274,903 (GRCm39) V620I probably benign Het
Ipo13 C A 4: 117,761,827 (GRCm39) E458* probably null Het
Ipp G T 4: 116,395,082 (GRCm39) G539V probably null Het
Iqca1 A T 1: 89,973,447 (GRCm39) V775E probably benign Het
Iqcf3 G T 9: 106,438,187 (GRCm39) P12Q unknown Het
Iqck C A 7: 118,540,877 (GRCm39) R259S probably benign Het
Iqgap1 C A 7: 80,418,057 (GRCm39) K104N probably benign Het
Iqgap2 A G 13: 95,867,951 (GRCm39) I219T possibly damaging Het
Irag1 C T 7: 110,523,206 (GRCm39) R79H probably benign Het
Irgq G T 7: 24,231,226 (GRCm39) G139V probably damaging Het
Irs2 T G 8: 11,056,185 (GRCm39) D749A probably damaging Het
Irx6 C A 8: 93,404,999 (GRCm39) P289H possibly damaging Het
Isl2 C A 9: 55,449,499 (GRCm39) C58* probably null Het
Ism1 A C 2: 139,573,794 (GRCm39) N48T probably benign Het
Itga7 A C 10: 128,789,696 (GRCm39) K1012T probably benign Het
Itga8 C A 2: 12,266,947 (GRCm39) A163S probably benign Het
Itga8 C A 2: 12,306,643 (GRCm39) probably benign Het
Itga8 A C 2: 12,252,329 (GRCm39) F294V probably damaging Het
Itga9 G A 9: 118,716,907 (GRCm39) V990M probably damaging Het
Itga9 A C 9: 118,672,598 (GRCm39) D790A probably benign Het
Itgad T A 7: 127,789,259 (GRCm39) N574K probably damaging Het
Itgax G C 7: 127,744,044 (GRCm39) R909T probably benign Het
Itgb2 A T 10: 77,393,796 (GRCm39) Q412L probably benign Het
Itgb3 G T 11: 104,534,449 (GRCm39) K435N possibly damaging Het
Itgb4 G A 11: 115,897,346 (GRCm39) G1536R probably damaging Het
Itgb6 G C 2: 60,441,812 (GRCm39) S666C possibly damaging Het
Itgbl1 G T 14: 124,192,084 (GRCm39) G373C probably damaging Het
Itih4 GAA G 14: 30,621,419 (GRCm39) probably null Het
Itm2c G A 1: 85,834,248 (GRCm39) V188M possibly damaging Het
Itpka G C 2: 119,573,281 (GRCm39) S141T probably damaging Het
Itpkc C A 7: 26,927,063 (GRCm39) D284Y probably benign Het
Itpr1 T A 6: 108,476,110 (GRCm39) W2275R probably damaging Het
Ivd G T 2: 118,706,825 (GRCm39) K272N possibly damaging Het
Ivns1abp A G 1: 151,226,784 (GRCm39) E12G probably damaging Het
Jak1 C T 4: 101,020,919 (GRCm39) M640I probably benign Het
Jak1 C A 4: 101,020,878 (GRCm39) G654V probably damaging Het
Jak2 G A 19: 29,248,798 (GRCm39) E92K possibly damaging Het
Jak3 C G 8: 72,133,327 (GRCm39) A340G possibly damaging Het
Jakmip3 G T 7: 138,621,862 (GRCm39) R254L probably benign Het
Jmjd1c T C 10: 67,073,953 (GRCm39) L1896P probably benign Het
Jph1 C T 1: 17,167,576 (GRCm39) E85K possibly damaging Het
Jph4 G A 14: 55,351,105 (GRCm39) R304C probably benign Het
Jun T A 4: 94,939,615 (GRCm39) probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,666,531 (GRCm39) probably null Het
Kash5 C G 7: 44,833,678 (GRCm39) probably null Het
Kat6a C G 8: 23,400,170 (GRCm39) C310W probably damaging Het
Katna1 G T 10: 7,635,549 (GRCm39) S328I probably damaging Het
Katnal2 T C 18: 77,099,753 (GRCm39) K127R probably benign Het
Kbtbd2 T G 6: 56,757,294 (GRCm39) E147D probably damaging Het
Kcna3 A T 3: 106,944,582 (GRCm39) N282Y probably damaging Het
Kcna5 T A 6: 126,510,679 (GRCm39) K483M probably damaging Het
Kcnb1 G T 2: 167,030,322 (GRCm39) D74E probably damaging Het
Kcne2 C T 16: 92,093,479 (GRCm39) A2V probably benign Het
Kcnh1 C A 1: 192,101,045 (GRCm39) R573S probably damaging Het
Kcnh8 C A 17: 53,201,089 (GRCm39) L508I probably damaging Het
Kcnj2 G T 11: 110,962,961 (GRCm39) V118L probably benign Het
Kcnk18 G T 19: 59,223,391 (GRCm39) A179S probably benign Het
Kcnq4 A C 4: 120,555,694 (GRCm39) probably null Het
Kcns1 G A 2: 164,010,553 (GRCm39) H69Y probably benign Het
Kcnt1 G C 2: 25,796,808 (GRCm39) R809P probably benign Het
Kcnt2 G C 1: 140,304,099 (GRCm39) W156C probably damaging Het
Kcnv2 G T 19: 27,300,838 (GRCm39) A230S probably benign Het
Kcp T A 6: 29,485,011 (GRCm39) E1247V probably benign Het
Kctd1 C T 18: 15,196,182 (GRCm39) S147N unknown Het
Kctd12 C G 14: 103,219,354 (GRCm39) G175R not run Het
Kctd19 A C 8: 106,111,768 (GRCm39) F842V probably damaging Het
Kdm3b G T 18: 34,942,122 (GRCm39) E738* probably null Het
Kdm4a T A 4: 118,034,699 (GRCm39) S11C probably benign Het
Kdm4a C T 4: 118,010,387 (GRCm39) E619K probably benign Het
Kdm5b G A 1: 134,552,773 (GRCm39) D1250N probably damaging Het
Kel G T 6: 41,664,506 (GRCm39) P644T probably damaging Het
Khdc1c G T 1: 21,439,787 (GRCm39) E113* probably null Het
Khdrbs2 G T 1: 32,372,743 (GRCm39) W139L unknown Het
Khdrbs3 T C 15: 68,889,316 (GRCm39) L155P probably damaging Het
Kif12 T G 4: 63,090,234 (GRCm39) E3D possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif13b C G 14: 65,040,793 (GRCm39) P1627R probably benign Het
Kif14 A T 1: 136,424,391 (GRCm39) Q1002L probably damaging Het
Kif14 G T 1: 136,427,754 (GRCm39) probably null Het
Kif18a G A 2: 109,148,398 (GRCm39) G631R possibly damaging Het
Kif19a C A 11: 114,680,655 (GRCm39) A925E probably benign Het
Kif19a A T 11: 114,677,416 (GRCm39) E600V probably damaging Het
Kif1a G A 1: 92,983,419 (GRCm39) P693S probably benign Het
Kif1a G A 1: 92,950,213 (GRCm39) R1405W probably damaging Het
Kif1a G C 1: 92,949,038 (GRCm39) L1495V probably damaging Het
Kif1b T G 4: 149,350,755 (GRCm39) K273T possibly damaging Het
Kif20b C G 19: 34,930,275 (GRCm39) S1260C probably benign Het
Kif21b C A 1: 136,081,875 (GRCm39) T641K probably benign Het
Kif26a G C 12: 112,144,052 (GRCm39) E1435D probably damaging Het
Kif28 T G 1: 179,560,699 (GRCm39) K202T probably benign Het
Kif2b C A 11: 91,467,090 (GRCm39) E398* probably null Het
Kirrel2 T C 7: 30,152,882 (GRCm39) T379A probably benign Het
Klf17 G T 4: 117,617,548 (GRCm39) R270S probably benign Het
Klhdc7a G T 4: 139,695,108 (GRCm39) probably benign Het
Klhdc8b T A 9: 108,325,576 (GRCm39) Q326L probably benign Het
Klhl18 C G 9: 110,266,415 (GRCm39) A300P probably null Het
Klhl2 C A 8: 65,211,160 (GRCm39) R296L probably damaging Het
Klhl22 G A 16: 17,594,560 (GRCm39) D230N probably benign Het
Klhl30 C G 1: 91,287,187 (GRCm39) A491G probably damaging Het
Klhl6 G T 16: 19,772,424 (GRCm39) T307N probably damaging Het
Klk1b8 C A 7: 43,453,149 (GRCm39) R247S possibly damaging Het
Klkb1 G T 8: 45,726,666 (GRCm39) R446S probably damaging Het
Klra1 C G 6: 130,349,814 (GRCm39) W208S probably damaging Het
Klra3 C A 6: 130,312,684 (GRCm39) E27* probably null Het
Klra5 G C 6: 129,888,415 (GRCm39) P4A not run Het
Klrb1a GT G 6: 128,595,548 (GRCm39) probably null Het
Kmt2a C A 9: 44,759,276 (GRCm39) D858Y probably damaging Het
Kmt2b C A 7: 30,276,795 (GRCm39) R1674L probably damaging Het
Kmt2c G C 5: 25,559,411 (GRCm39) A1076G probably damaging Het
Kmt5b G T 19: 3,843,118 (GRCm39) G72* probably null Het
Kng1 G T 16: 22,898,366 (GRCm39) V589L probably benign Het
Kplce T C 3: 92,776,581 (GRCm39) Q34R probably benign Het
Kpna6 T A 4: 129,541,871 (GRCm39) S509C possibly damaging Het
Kpna6 C A 4: 129,549,341 (GRCm39) W147L probably damaging Het
Krt12 C A 11: 99,311,587 (GRCm39) E205* probably null Het
Krt17 T G 11: 100,151,749 (GRCm39) K15Q probably benign Het
Krt222 A T 11: 99,129,378 (GRCm39) L143Q probably damaging Het
Krt24 C G 11: 99,175,712 (GRCm39) G108R unknown Het
Krt25 C G 11: 99,213,648 (GRCm39) A24P probably benign Het
Krt27 C A 11: 99,239,804 (GRCm39) E253D probably damaging Het
Krt33a C A 11: 99,902,740 (GRCm39) E361D probably benign Het
Krt34 G T 11: 99,932,260 (GRCm39) C21* probably null Het
Krt82 C T 15: 101,450,287 (GRCm39) V470I probably benign Het
Krtap1-3 A G 11: 99,481,821 (GRCm39) C109R possibly damaging Het
Krtap16-1 C T 11: 99,876,423 (GRCm39) R327Q possibly damaging Het
Krtap21-1 C A 16: 89,200,469 (GRCm39) G58C unknown Het
Krtap28-13 G T 1: 83,038,811 (GRCm39) C32F unknown Het
Krtap3-1 G C 11: 99,457,393 (GRCm39) A6G probably benign Het
Krtap4-2 C A 11: 99,525,802 (GRCm39) G17C unknown Het
Krtap6-1 G C 16: 88,828,697 (GRCm39) C31S unknown Het
Krtap7-1 C A 16: 89,305,148 (GRCm39) M1I probably null Het
Ksr1 C A 11: 78,911,577 (GRCm39) R735L possibly damaging Het
Ksr1 C A 11: 78,918,426 (GRCm39) R576L probably benign Het
Kyat1 G T 2: 30,077,744 (GRCm39) T175N probably damaging Het
L2hgdh C T 12: 69,753,906 (GRCm39) S233N probably benign Het
L3mbtl4 G T 17: 68,732,682 (GRCm39) W54L probably damaging Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Lamb1 A T 12: 31,377,701 (GRCm39) S1697C possibly damaging Het
Lamb2 G T 9: 108,360,100 (GRCm39) G419C probably damaging Het
Lamc2 C A 1: 153,009,367 (GRCm39) V813L probably benign Het
Lamp2 T C X: 37,513,258 (GRCm39) S332G probably damaging Het
Lao1 C A 4: 118,825,637 (GRCm39) H486N probably damaging Het
Large2 G C 2: 92,200,543