Incidental Mutation 'R0667:Mtf2'
ID62058
Institutional Source Beutler Lab
Gene Symbol Mtf2
Ensembl Gene ENSMUSG00000029267
Gene Namemetal response element binding transcription factor 2
SynonymsPcl2, C76717, 9230112N11Rik, M96
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R0667 (G1)
Quality Score124
Status Not validated
Chromosome5
Chromosomal Location108065674-108109004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108104503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 409 (T409I)
Ref Sequence ENSEMBL: ENSMUSP00000108245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081567] [ENSMUST00000112626] [ENSMUST00000118036] [ENSMUST00000124195] [ENSMUST00000134026] [ENSMUST00000143412]
Predicted Effect probably damaging
Transcript: ENSMUST00000081567
AA Change: T466I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080278
Gene: ENSMUSG00000029267
AA Change: T466I

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 496 508 N/A INTRINSIC
Pfam:Mtf2_C 544 591 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112626
AA Change: T409I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108245
Gene: ENSMUSG00000029267
AA Change: T409I

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 439 451 N/A INTRINSIC
Pfam:Mtf2_C 485 535 5.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118036
SMART Domains Protein: ENSMUSP00000113922
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 99 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124195
SMART Domains Protein: ENSMUSP00000126297
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PDB:2EQJ|A 36 70 2e-17 PDB
Blast:TUDOR 44 75 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131291
Predicted Effect probably benign
Transcript: ENSMUST00000134026
SMART Domains Protein: ENSMUSP00000128797
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137996
SMART Domains Protein: ENSMUSP00000121697
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PHD 10 61 3.37e-11 SMART
PHD 109 159 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141592
Predicted Effect probably benign
Transcript: ENSMUST00000143412
SMART Domains Protein: ENSMUSP00000132596
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
TUDOR 44 101 1.22e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198662
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vertebral transformation and delayed replicative senescence in MEFs. Mice homozygous for one gene trap allele exhibit postnatal lethality, vertebral transformation and delayed replicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Mtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Mtf2 APN 5 108106890 missense probably damaging 1.00
IGL01367:Mtf2 APN 5 108104457 missense probably benign 0.44
IGL01452:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01459:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01460:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01809:Mtf2 APN 5 108087325 missense probably benign 0.27
IGL03166:Mtf2 APN 5 108106720 missense probably benign 0.28
R1533:Mtf2 UTSW 5 108092129 missense probably damaging 1.00
R1664:Mtf2 UTSW 5 108104476 missense probably damaging 1.00
R1723:Mtf2 UTSW 5 108088070 missense probably damaging 1.00
R2154:Mtf2 UTSW 5 108080931 missense possibly damaging 0.79
R2213:Mtf2 UTSW 5 108100914 missense possibly damaging 0.95
R3904:Mtf2 UTSW 5 108081000 missense probably damaging 1.00
R4320:Mtf2 UTSW 5 108087025 missense probably damaging 1.00
R4560:Mtf2 UTSW 5 108086989 splice site probably null
R4764:Mtf2 UTSW 5 108093352 missense probably benign 0.43
R4989:Mtf2 UTSW 5 108073028 intron probably benign
R5305:Mtf2 UTSW 5 108104499 missense possibly damaging 0.84
R5356:Mtf2 UTSW 5 108106610 missense possibly damaging 0.92
R5528:Mtf2 UTSW 5 108094157 missense probably damaging 1.00
R6021:Mtf2 UTSW 5 108081137 missense possibly damaging 0.93
R7164:Mtf2 UTSW 5 108093369 missense possibly damaging 0.53
R7426:Mtf2 UTSW 5 108100970 missense probably benign
Z1088:Mtf2 UTSW 5 108087329 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGTCCTCCTGGCCCATATACAAG -3'
(R):5'- CTGTAGCCAGTCCTACAAGTATACCCC -3'

Sequencing Primer
(F):5'- AAACTGCTGAGCTACCTTTGG -3'
(R):5'- gtcctacaagtatacccctATATGCC -3'
Posted On2013-07-30