Incidental Mutation 'R0667:Prmt3'
ID62060
Institutional Source Beutler Lab
Gene Symbol Prmt3
Ensembl Gene ENSMUSG00000030505
Gene Nameprotein arginine N-methyltransferase 3
SynonymsHrmt1l3, 2010005E20Rik, 2410018A17Rik
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R0667 (G1)
Quality Score131
Status Validated
Chromosome7
Chromosomal Location49778346-49858265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49791995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 240 (Y240C)
Ref Sequence ENSEMBL: ENSMUSP00000032715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032715] [ENSMUST00000147401]
Predicted Effect probably damaging
Transcript: ENSMUST00000032715
AA Change: Y240C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032715
Gene: ENSMUSG00000030505
AA Change: Y240C

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
ZnF_C2H2 46 69 2.41e1 SMART
coiled coil region 156 191 N/A INTRINSIC
Pfam:PRMT5 212 508 5.7e-8 PFAM
Pfam:Methyltransf_9 220 392 9.3e-9 PFAM
Pfam:MTS 242 326 5.4e-7 PFAM
Pfam:PrmA 245 343 4.3e-13 PFAM
Pfam:Methyltransf_31 250 407 8.8e-11 PFAM
Pfam:Methyltransf_18 252 360 2.5e-11 PFAM
Pfam:Methyltransf_11 257 356 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146052
Predicted Effect probably benign
Transcript: ENSMUST00000147401
SMART Domains Protein: ENSMUSP00000115155
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
PDB:1WIR|A 38 64 1e-13 PDB
Blast:ZnF_C2H2 46 64 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207216
Meta Mutation Damage Score 0.442 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit a reduced embryonic size but survive birth and attain a normal size in adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Prmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Prmt3 APN 7 49792009 missense probably damaging 1.00
IGL01444:Prmt3 APN 7 49780372 missense probably benign 0.00
IGL01688:Prmt3 APN 7 49848732 splice site probably null
IGL02041:Prmt3 APN 7 49828963 missense possibly damaging 0.91
IGL02304:Prmt3 APN 7 49826737 missense probably benign 0.44
IGL02389:Prmt3 APN 7 49848758 nonsense probably null
IGL02879:Prmt3 APN 7 49818063 missense probably benign 0.39
K7894:Prmt3 UTSW 7 49826711 missense probably damaging 1.00
R0616:Prmt3 UTSW 7 49787328 missense probably damaging 1.00
R1170:Prmt3 UTSW 7 49848547 critical splice donor site probably null
R1343:Prmt3 UTSW 7 49818108 missense probably benign 0.19
R1562:Prmt3 UTSW 7 49826854 missense probably benign 0.00
R1614:Prmt3 UTSW 7 49826719 missense possibly damaging 0.95
R1777:Prmt3 UTSW 7 49798346 missense possibly damaging 0.92
R3113:Prmt3 UTSW 7 49782012 missense probably damaging 1.00
R4170:Prmt3 UTSW 7 49826776 missense probably benign 0.01
R4403:Prmt3 UTSW 7 49780357 missense probably damaging 1.00
R4463:Prmt3 UTSW 7 49818089 missense probably damaging 1.00
R4962:Prmt3 UTSW 7 49826809 missense probably benign 0.00
R5144:Prmt3 UTSW 7 49786135 missense possibly damaging 0.48
R5364:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5586:Prmt3 UTSW 7 49826751 missense probably damaging 1.00
R5624:Prmt3 UTSW 7 49780334 missense probably damaging 0.97
R5820:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5992:Prmt3 UTSW 7 49828947 missense probably benign 0.00
R6931:Prmt3 UTSW 7 49829016 missense probably benign 0.00
R7117:Prmt3 UTSW 7 49818095 missense probably benign 0.00
X0064:Prmt3 UTSW 7 49781974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCTATTGGTGACCAGTGTGGAAAG -3'
(R):5'- ACAGCTCCGTTCCTGTAATGAATGAC -3'

Sequencing Primer
(F):5'- ctccccacccacctccc -3'
(R):5'- CCGTTCCTGTAATGAATGACTTTCAG -3'
Posted On2013-07-30