Mutagenetix > Incidental Mutations

Incidental Mutation 'R0667:Vps13c'

62067

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

038852-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0667 (G1)

Quality Score

116

Status

Validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 67951573 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 2768 (W2768*)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879]

Predicted Effect

probably null
Transcript: ENSMUST00000077879
AA Change: W2768*

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: W2768*

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213168

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	G	7: 140,261,537	S251R	possibly damaging	Het
Abca5	G	T	11: 110,327,811	N76K	probably benign	Het
Adamts12	C	T	15: 11,215,624	R244C	probably damaging	Het
Atad2	A	G	15: 58,098,719	S1143P	probably benign	Het
Avl9	G	T	6: 56,736,483	R242L	probably benign	Het
Cand1	A	G	10: 119,216,520	S234P	probably benign	Het
Cd200	T	A	16: 45,394,857	I144L	probably benign	Het
Cep76	A	T	18: 67,634,778	L228Q	possibly damaging	Het
Col12a1	A	G	9: 79,628,462	L2584S	probably damaging	Het
Col6a3	A	C	1: 90,828,101	D155E	probably damaging	Het
Col6a4	G	A	9: 106,029,959		probably benign	Het
Dsg2	A	C	18: 20,573,499	D24A	possibly damaging	Het
Gm5901	G	A	7: 105,377,490	S155N	possibly damaging	Het
Hkdc1	T	C	10: 62,411,865		probably benign	Het
Kansl1	A	G	11: 104,343,538	V714A	probably benign	Het
Kcnh1	T	A	1: 192,506,038	S936T	probably benign	Het
Klhdc3	A	T	17: 46,677,225	F205I	probably benign	Het
Krt31	T	A	11: 100,048,125	H290L	probably benign	Het
Lama2	T	A	10: 27,344,410		probably null	Het
Mep1a	T	G	17: 43,478,190	D565A	probably benign	Het
Mgme1	T	A	2: 144,278,987		probably benign	Het
Mtf2	C	T	5: 108,104,503	T409I	probably damaging	Het
Mylk3	A	G	8: 85,355,165		probably null	Het
Myo1c	A	G	11: 75,668,512	E650G	probably damaging	Het
Nipbl	A	C	15: 8,361,004	D260E	possibly damaging	Het
Nufip2	T	A	11: 77,692,013	V251D	possibly damaging	Het
Olfr1239	T	C	2: 89,417,688	I242V	probably benign	Het
Olfr138	C	A	17: 38,275,157	P129T	probably damaging	Het
Olfr855	T	A	9: 19,585,447	N303K	probably benign	Het
Osm	G	T	11: 4,239,918	R234L	possibly damaging	Het
Pabpc1	G	A	15: 36,598,031	A515V	probably benign	Het
Piwil1	T	A	5: 128,741,478		probably null	Het
Pld1	A	G	3: 28,079,178		probably null	Het
Plekhg3	C	T	12: 76,576,598	R871C	probably damaging	Het
Ppfia2	A	T	10: 106,913,694	Y1147F	probably damaging	Het
Prmt3	A	G	7: 49,791,995	Y240C	probably damaging	Het
Prr36	G	T	8: 4,216,311		probably benign	Het
Ptprd	A	G	4: 75,957,346	I908T	probably damaging	Het
Sae1	A	T	7: 16,368,532	N172K	probably damaging	Het
Satb1	T	G	17: 51,782,861	Q319H	probably damaging	Het
Scn2a	A	T	2: 65,751,996	I1563F	possibly damaging	Het
Scn3a	C	A	2: 65,484,411	R1102L	probably null	Het
Serpinb9b	T	A	13: 33,032,926	L60*	probably null	Het
Setd1a	A	G	7: 127,786,593	D281G	probably damaging	Het
Slc8a1	C	A	17: 81,648,881	V243F	probably damaging	Het
Tgfbr3	A	T	5: 107,177,850	H115Q	probably benign	Het
Tiam1	C	A	16: 89,897,984	S195I	probably damaging	Het
Tjp2	A	G	19: 24,108,749	V803A	probably benign	Het
Ttc5	T	A	14: 50,765,958	Q423L	probably benign	Het
Tyk2	A	C	9: 21,108,871	V997G	probably damaging	Het
Uhrf1	T	C	17: 56,310,677	V133A	probably benign	Het
Vmn2r107	A	C	17: 20,355,654	Y82S	possibly damaging	Het
Vmn2r93	T	C	17: 18,326,241	F792L	probably damaging	Het
Zfp456	A	T	13: 67,366,742	C282S	probably benign	Het
Zhx1	T	C	15: 58,053,165	N562D	possibly damaging	Het
Zmynd15	G	T	11: 70,465,118	G481C	probably damaging	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACGGATCAGTGGCGAGATCATAG -3'
(R):5'- GCAGCAGGACTTCAATGACAGCAG -3'

Sequencing Primer
(F):5'- AGCTCGTCCTGGTGAAATAC -3'
(R):5'- TCTTATAGCCCTGAAGAACGG -3'

Posted On

2013-07-30