Incidental Mutation 'R0667:Nipbl'
ID62076
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene NameNIPBL cohesin loading factor
Synonyms4921518A06Rik, 4933421G18Rik
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0667 (G1)
Quality Score115
Status Validated
Chromosome15
Chromosomal Location8290617-8444463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8361004 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 260 (D260E)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052965
AA Change: D260E

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: D260E

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTAAATCCCTTTTCAGGAGGTGC -3'
(R):5'- ACGCTGCCCTCAGACATTTATGG -3'

Sequencing Primer
(F):5'- GCACAGTTGAGTCTGATTAAACAG -3'
(R):5'- CATTGCCATGCATAGGCTG -3'
Posted On2013-07-30