Mutagenetix > Incidental Mutation

Incidental Mutation 'R0667:Nipbl'

62076

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4933421G18Rik, 4921518A06Rik

MMRRC Submission

038852-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0667 (G1)

Quality Score

115

Status

Validated

Chromosome

Chromosomal Location

8320101-8473947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 8390488 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 260 (D260E)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052965
AA Change: D260E

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: D260E

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	T	11: 110,218,637 (GRCm39)	N76K	probably benign	Het
Adamts12	C	T	15: 11,215,710 (GRCm39)	R244C	probably damaging	Het
Atad2	A	G	15: 57,962,115 (GRCm39)	S1143P	probably benign	Het
Avl9	G	T	6: 56,713,468 (GRCm39)	R242L	probably benign	Het
Cand1	A	G	10: 119,052,425 (GRCm39)	S234P	probably benign	Het
Cd200	T	A	16: 45,215,220 (GRCm39)	I144L	probably benign	Het
Cep76	A	T	18: 67,767,848 (GRCm39)	L228Q	possibly damaging	Het
Col12a1	A	G	9: 79,535,744 (GRCm39)	L2584S	probably damaging	Het
Col6a3	A	C	1: 90,755,823 (GRCm39)	D155E	probably damaging	Het
Col6a4	G	A	9: 105,907,158 (GRCm39)		probably benign	Het
Dsg2	A	C	18: 20,706,556 (GRCm39)	D24A	possibly damaging	Het
Gm5901	G	A	7: 105,026,697 (GRCm39)	S155N	possibly damaging	Het
Hkdc1	T	C	10: 62,247,644 (GRCm39)		probably benign	Het
Kansl1	A	G	11: 104,234,364 (GRCm39)	V714A	probably benign	Het
Kcnh1	T	A	1: 192,188,346 (GRCm39)	S936T	probably benign	Het
Klhdc3	A	T	17: 46,988,151 (GRCm39)	F205I	probably benign	Het
Krt31	T	A	11: 99,938,951 (GRCm39)	H290L	probably benign	Het
Lama2	T	A	10: 27,220,406 (GRCm39)		probably null	Het
Mep1a	T	G	17: 43,789,081 (GRCm39)	D565A	probably benign	Het
Mgme1	T	A	2: 144,120,907 (GRCm39)		probably benign	Het
Mtf2	C	T	5: 108,252,369 (GRCm39)	T409I	probably damaging	Het
Mylk3	A	G	8: 86,081,794 (GRCm39)		probably null	Het
Myo1c	A	G	11: 75,559,338 (GRCm39)	E650G	probably damaging	Het
Nufip2	T	A	11: 77,582,839 (GRCm39)	V251D	possibly damaging	Het
Or2n1e	C	A	17: 38,586,048 (GRCm39)	P129T	probably damaging	Het
Or4a2	T	C	2: 89,248,032 (GRCm39)	I242V	probably benign	Het
Or7g35	T	A	9: 19,496,743 (GRCm39)	N303K	probably benign	Het
Osm	G	T	11: 4,189,918 (GRCm39)	R234L	possibly damaging	Het
Pabpc1	G	A	15: 36,598,275 (GRCm39)	A515V	probably benign	Het
Piwil1	T	A	5: 128,818,542 (GRCm39)		probably null	Het
Pld1	A	G	3: 28,133,327 (GRCm39)		probably null	Het
Plekhg3	C	T	12: 76,623,372 (GRCm39)	R871C	probably damaging	Het
Ppfia2	A	T	10: 106,749,555 (GRCm39)	Y1147F	probably damaging	Het
Prmt3	A	G	7: 49,441,743 (GRCm39)	Y240C	probably damaging	Het
Prr36	G	T	8: 4,266,311 (GRCm39)		probably benign	Het
Ptprd	A	G	4: 75,875,583 (GRCm39)	I908T	probably damaging	Het
Sae1	A	T	7: 16,102,457 (GRCm39)	N172K	probably damaging	Het
Satb1	T	G	17: 52,089,889 (GRCm39)	Q319H	probably damaging	Het
Scart2	C	G	7: 139,841,450 (GRCm39)	S251R	possibly damaging	Het
Scn2a	A	T	2: 65,582,340 (GRCm39)	I1563F	possibly damaging	Het
Scn3a	C	A	2: 65,314,755 (GRCm39)	R1102L	probably null	Het
Serpinb9b	T	A	13: 33,216,909 (GRCm39)	L60*	probably null	Het
Setd1a	A	G	7: 127,385,765 (GRCm39)	D281G	probably damaging	Het
Slc8a1	C	A	17: 81,956,310 (GRCm39)	V243F	probably damaging	Het
Tgfbr3	A	T	5: 107,325,716 (GRCm39)	H115Q	probably benign	Het
Tiam1	C	A	16: 89,694,872 (GRCm39)	S195I	probably damaging	Het
Tjp2	A	G	19: 24,086,113 (GRCm39)	V803A	probably benign	Het
Ttc5	T	A	14: 51,003,415 (GRCm39)	Q423L	probably benign	Het
Tyk2	A	C	9: 21,020,167 (GRCm39)	V997G	probably damaging	Het
Uhrf1	T	C	17: 56,617,677 (GRCm39)	V133A	probably benign	Het
Vmn2r107	A	C	17: 20,575,916 (GRCm39)	Y82S	possibly damaging	Het
Vmn2r93	T	C	17: 18,546,503 (GRCm39)	F792L	probably damaging	Het
Vps13c	G	A	9: 67,858,855 (GRCm39)	W2768*	probably null	Het
Zfp456	A	T	13: 67,514,861 (GRCm39)	C282S	probably benign	Het
Zhx1	T	C	15: 57,916,561 (GRCm39)	N562D	possibly damaging	Het
Zmynd15	G	T	11: 70,355,944 (GRCm39)	G481C	probably damaging	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,396,157 (GRCm39)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,398,958 (GRCm39)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,326,353 (GRCm39)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,379,939 (GRCm39)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,379,981 (GRCm39)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,340,693 (GRCm39)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,380,023 (GRCm39)	missense	probably benign
IGL01723:Nipbl	APN	15	8,364,555 (GRCm39)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,391,305 (GRCm39)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,356,574 (GRCm39)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,388,558 (GRCm39)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,373,058 (GRCm39)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,353,131 (GRCm39)	splice site	probably null
IGL02547:Nipbl	APN	15	8,381,082 (GRCm39)	missense	probably benign
IGL02678:Nipbl	APN	15	8,380,594 (GRCm39)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,325,037 (GRCm39)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,379,798 (GRCm39)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,361,936 (GRCm39)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,368,463 (GRCm39)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,322,569 (GRCm39)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,380,360 (GRCm39)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,391,221 (GRCm39)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R0422:Nipbl	UTSW	15	8,381,112 (GRCm39)	missense	probably benign
R0486:Nipbl	UTSW	15	8,368,354 (GRCm39)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,332,964 (GRCm39)	missense	probably benign	0.23
R0689:Nipbl	UTSW	15	8,322,562 (GRCm39)	splice site	probably null
R0726:Nipbl	UTSW	15	8,381,039 (GRCm39)	missense	probably benign
R0881:Nipbl	UTSW	15	8,337,096 (GRCm39)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,391,202 (GRCm39)	missense	probably benign
R0969:Nipbl	UTSW	15	8,321,712 (GRCm39)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,401,657 (GRCm39)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,379,773 (GRCm39)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,380,764 (GRCm39)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,396,148 (GRCm39)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,332,396 (GRCm39)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,368,035 (GRCm39)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,348,972 (GRCm39)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,373,001 (GRCm39)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,356,616 (GRCm39)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,379,771 (GRCm39)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,353,951 (GRCm39)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,340,691 (GRCm39)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,366,403 (GRCm39)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,322,702 (GRCm39)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,380,966 (GRCm39)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,364,490 (GRCm39)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,353,182 (GRCm39)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,340,723 (GRCm39)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,373,076 (GRCm39)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,325,145 (GRCm39)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,388,358 (GRCm39)	missense	probably benign
R3902:Nipbl	UTSW	15	8,379,730 (GRCm39)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,380,018 (GRCm39)	missense	probably benign
R4164:Nipbl	UTSW	15	8,368,418 (GRCm39)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,361,916 (GRCm39)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,388,690 (GRCm39)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,391,345 (GRCm39)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,368,208 (GRCm39)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,332,468 (GRCm39)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,395,313 (GRCm39)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,380,981 (GRCm39)	missense	probably benign
R5428:Nipbl	UTSW	15	8,359,780 (GRCm39)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,396,196 (GRCm39)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5644:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5681:Nipbl	UTSW	15	8,330,866 (GRCm39)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,354,133 (GRCm39)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,364,328 (GRCm39)	splice site	probably null
R5970:Nipbl	UTSW	15	8,326,302 (GRCm39)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,353,748 (GRCm39)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,325,052 (GRCm39)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,364,390 (GRCm39)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,347,867 (GRCm39)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,354,064 (GRCm39)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,381,049 (GRCm39)	missense	probably benign
R6707:Nipbl	UTSW	15	8,354,043 (GRCm39)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,352,074 (GRCm39)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,332,969 (GRCm39)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,321,619 (GRCm39)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,373,090 (GRCm39)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,359,779 (GRCm39)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,325,120 (GRCm39)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,372,977 (GRCm39)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,335,356 (GRCm39)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,322,585 (GRCm39)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,381,010 (GRCm39)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,388,186 (GRCm39)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,326,333 (GRCm39)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,320,971 (GRCm39)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,355,236 (GRCm39)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,340,742 (GRCm39)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,340,734 (GRCm39)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,388,696 (GRCm39)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,368,225 (GRCm39)	missense	probably benign
R8739:Nipbl	UTSW	15	8,332,904 (GRCm39)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,330,210 (GRCm39)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,391,271 (GRCm39)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,381,104 (GRCm39)	missense	probably benign
R8991:Nipbl	UTSW	15	8,320,997 (GRCm39)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,356,608 (GRCm39)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,368,215 (GRCm39)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,380,340 (GRCm39)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,366,373 (GRCm39)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,321,032 (GRCm39)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,388,418 (GRCm39)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,381,199 (GRCm39)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,353,021 (GRCm39)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,337,366 (GRCm39)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,368,183 (GRCm39)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,368,164 (GRCm39)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,366,436 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGTAAATCCCTTTTCAGGAGGTGC -3'
(R):5'- ACGCTGCCCTCAGACATTTATGG -3'

Sequencing Primer
(F):5'- GCACAGTTGAGTCTGATTAAACAG -3'
(R):5'- CATTGCCATGCATAGGCTG -3'

Posted On

2013-07-30