Incidental Mutation 'R0668:Vmn1r32'
ID62091
Institutional Source Beutler Lab
Gene Symbol Vmn1r32
Ensembl Gene ENSMUSG00000062905
Gene Namevomeronasal 1 receptor 32
SynonymsV1rc15
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0668 (G1)
Quality Score182
Status Not validated
Chromosome6
Chromosomal Location66552180-66560096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66553660 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 44 (Q44L)
Ref Sequence ENSEMBL: ENSMUSP00000153723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079584] [ENSMUST00000227014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079584
AA Change: Q44L

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078536
Gene: ENSMUSG00000062905
AA Change: Q44L

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227014
AA Change: Q44L

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Vmn1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Vmn1r32 APN 6 66552932 missense probably benign
IGL02399:Vmn1r32 APN 6 66552929 missense probably benign 0.18
IGL02964:Vmn1r32 APN 6 66552938 missense probably benign 0.37
IGL03161:Vmn1r32 APN 6 66553220 missense possibly damaging 0.65
IGL03244:Vmn1r32 APN 6 66553505 missense probably damaging 1.00
IGL03248:Vmn1r32 APN 6 66552913 missense possibly damaging 0.82
R0732:Vmn1r32 UTSW 6 66553706 missense probably benign 0.01
R1205:Vmn1r32 UTSW 6 66553555 missense probably benign 0.01
R1638:Vmn1r32 UTSW 6 66552955 missense possibly damaging 0.53
R1732:Vmn1r32 UTSW 6 66553301 missense probably benign 0.19
R2049:Vmn1r32 UTSW 6 66553561 missense probably damaging 1.00
R2127:Vmn1r32 UTSW 6 66553549 missense probably benign 0.09
R3773:Vmn1r32 UTSW 6 66553367 missense probably benign 0.01
R3834:Vmn1r32 UTSW 6 66553663 missense probably benign 0.02
R3980:Vmn1r32 UTSW 6 66553714 missense probably damaging 0.98
R4737:Vmn1r32 UTSW 6 66553645 missense probably damaging 1.00
R5569:Vmn1r32 UTSW 6 66553172 missense probably damaging 0.98
R6382:Vmn1r32 UTSW 6 66553361 missense probably benign 0.07
R6894:Vmn1r32 UTSW 6 66553361 missense possibly damaging 0.94
R7394:Vmn1r32 UTSW 6 66553189 missense probably benign 0.06
R7980:Vmn1r32 UTSW 6 66553321 nonsense probably null
R8833:Vmn1r32 UTSW 6 66553639 missense possibly damaging 0.53
R8867:Vmn1r32 UTSW 6 66553667 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACACTCAGGAGACAGGTGATGC -3'
(R):5'- ACTGGATTTCTACCTATGAGGCTCAGG -3'

Sequencing Primer
(F):5'- CAGGTGATGCAGATAGAGAGGC -3'
(R):5'- GGCTCAGGTATAATAAATACACAGC -3'
Posted On2013-07-30