Incidental Mutation 'R0668:Arhgef1'
ID 62094
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene Name Rho guanine nucleotide exchange factor 1
Synonyms Lbcl2, Lsc
MMRRC Submission 038853-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R0668 (G1)
Quality Score 140
Status Not validated
Chromosome 7
Chromosomal Location 24602337-24626019 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24607345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 31 (N31D)
Ref Sequence ENSEMBL: ENSMUSP00000113771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000151121] [ENSMUST00000205295] [ENSMUST00000206011] [ENSMUST00000206508] [ENSMUST00000206906] [ENSMUST00000206028]
AlphaFold Q61210
Predicted Effect probably benign
Transcript: ENSMUST00000047873
AA Change: N31D

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: N31D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
AA Change: N31D

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: N31D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
AA Change: N31D

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: N31D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117796
AA Change: N31D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: N31D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144714
Predicted Effect possibly damaging
Transcript: ENSMUST00000151121
AA Change: N31D

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114388
Gene: ENSMUSG00000040940
AA Change: N31D

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 101 5.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205295
AA Change: N31D

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206011
AA Change: N31D

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000206508
AA Change: N31D

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000206906
AA Change: N31D

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably benign
Transcript: ENSMUST00000206028
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,302,773 (GRCm39) Q2149K probably damaging Het
Aifm1 T C X: 47,583,668 (GRCm39) Q210R probably benign Het
Asic5 T A 3: 81,928,308 (GRCm39) Y424N probably damaging Het
Bltp3a A T 17: 28,114,913 (GRCm39) I1408F probably benign Het
Cfb G T 17: 35,076,079 (GRCm39) Q1176K probably benign Het
Chdh A G 14: 29,757,837 (GRCm39) H447R probably damaging Het
Cpd A C 11: 76,675,224 (GRCm39) V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 (GRCm38) probably null Het
Dnhd1 A G 7: 105,344,958 (GRCm39) T2101A probably benign Het
Efcab3 A T 11: 104,611,318 (GRCm39) I387F probably benign Het
Fchsd2 A G 7: 100,846,127 (GRCm39) K188E possibly damaging Het
Gm10549 A G 18: 33,603,903 (GRCm39) T129A unknown Het
Jph1 T A 1: 17,161,895 (GRCm39) T256S probably damaging Het
Kcnma1 A G 14: 23,417,563 (GRCm39) Y768H probably damaging Het
Lcmt1 G A 7: 123,002,094 (GRCm39) D120N probably damaging Het
Ly6g6d G A 17: 35,290,715 (GRCm39) H72Y probably damaging Het
Myom3 A G 4: 135,492,237 (GRCm39) D127G possibly damaging Het
Or10c1 T A 17: 37,522,535 (GRCm39) I70F probably damaging Het
Pira13 G A 7: 3,825,699 (GRCm39) T390I probably damaging Het
Sart1 T C 19: 5,434,284 (GRCm39) Y249C probably damaging Het
Scin A G 12: 40,130,948 (GRCm39) Y322H probably damaging Het
Slc44a3 T C 3: 121,303,852 (GRCm39) T295A probably damaging Het
Slc4a5 T A 6: 83,248,054 (GRCm39) L535Q probably damaging Het
Them5 A T 3: 94,251,720 (GRCm39) K110N probably benign Het
Vmn1r32 T A 6: 66,530,644 (GRCm39) Q44L possibly damaging Het
Vmn2r93 T A 17: 18,518,667 (GRCm39) M42K probably benign Het
Zfp143 A T 7: 109,660,481 (GRCm39) probably benign Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24,607,784 (GRCm39) missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24,612,118 (GRCm39) missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24,625,376 (GRCm39) unclassified probably benign
IGL01479:Arhgef1 APN 7 24,612,028 (GRCm39) missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24,621,307 (GRCm39) missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24,625,208 (GRCm39) critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24,622,796 (GRCm39) missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24,611,977 (GRCm39) splice site probably benign
IGL02202:Arhgef1 APN 7 24,612,854 (GRCm39) nonsense probably null
IGL02324:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24,623,157 (GRCm39) missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24,622,276 (GRCm39) missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24,616,268 (GRCm39) missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24,612,030 (GRCm39) nonsense probably null
R0277:Arhgef1 UTSW 7 24,623,224 (GRCm39) unclassified probably benign
R0336:Arhgef1 UTSW 7 24,621,382 (GRCm39) missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24,618,785 (GRCm39) intron probably benign
R1520:Arhgef1 UTSW 7 24,619,129 (GRCm39) missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24,624,423 (GRCm39) missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24,613,057 (GRCm39) missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24,607,176 (GRCm39) missense unknown
R3855:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24,611,996 (GRCm39) missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24,618,001 (GRCm39) intron probably benign
R4914:Arhgef1 UTSW 7 24,623,264 (GRCm39) missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24,624,447 (GRCm39) missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24,611,732 (GRCm39) splice site probably null
R5604:Arhgef1 UTSW 7 24,612,210 (GRCm39) missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24,618,782 (GRCm39) splice site probably null
R6151:Arhgef1 UTSW 7 24,617,367 (GRCm39) missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24,619,205 (GRCm39) splice site probably null
R6943:Arhgef1 UTSW 7 24,623,156 (GRCm39) missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24,616,348 (GRCm39) missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24,615,461 (GRCm39) missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24,612,003 (GRCm39) missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24,618,641 (GRCm39) missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24,619,163 (GRCm39) missense probably damaging 1.00
R8132:Arhgef1 UTSW 7 24,619,174 (GRCm39) nonsense probably null
R8132:Arhgef1 UTSW 7 24,607,087 (GRCm39) intron probably benign
R8168:Arhgef1 UTSW 7 24,624,831 (GRCm39) missense probably benign 0.06
R8964:Arhgef1 UTSW 7 24,622,462 (GRCm39) missense probably damaging 1.00
R9114:Arhgef1 UTSW 7 24,607,304 (GRCm39) missense probably damaging 1.00
R9553:Arhgef1 UTSW 7 24,619,115 (GRCm39) missense probably damaging 1.00
R9676:Arhgef1 UTSW 7 24,625,501 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAATCTGTGAGTAACTGCCCAGC -3'
(R):5'- TGCACCTCTCAATGGTTTCACGAC -3'

Sequencing Primer
(F):5'- TAACTGCCCAGCCTCGG -3'
(R):5'- AAGACTTGATGTTCCTGAGCC -3'
Posted On 2013-07-30