Incidental Mutation 'R0668:Scin'
ID62103
Institutional Source Beutler Lab
Gene Symbol Scin
Ensembl Gene ENSMUSG00000002565
Gene Namescinderin
Synonymsadseverin
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0668 (G1)
Quality Score81
Status Not validated
Chromosome12
Chromosomal Location40059769-40134228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40080949 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 322 (Y322H)
Ref Sequence ENSEMBL: ENSMUSP00000077573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002640
AA Change: Y322H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: Y322H

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 596 2.33e-23 SMART
GEL 615 710 2.07e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078481
AA Change: Y322H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: Y322H

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 610 1.09e-28 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Scin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Scin APN 12 40076972 missense probably benign 0.03
IGL01414:Scin APN 12 40124699 missense probably damaging 1.00
IGL01790:Scin APN 12 40063257 missense probably benign 0.02
IGL01807:Scin APN 12 40084289 missense probably damaging 1.00
IGL01946:Scin APN 12 40060491 utr 3 prime probably benign
IGL02040:Scin APN 12 40069453 intron probably benign
IGL02391:Scin APN 12 40077531 missense probably benign 0.05
IGL03221:Scin APN 12 40076974 missense probably benign 0.01
I1329:Scin UTSW 12 40073330 missense probably damaging 0.99
PIT4498001:Scin UTSW 12 40069447 critical splice acceptor site probably null
R0108:Scin UTSW 12 40127987 missense possibly damaging 0.68
R0470:Scin UTSW 12 40073292 splice site probably benign
R0477:Scin UTSW 12 40060516 missense probably damaging 1.00
R0538:Scin UTSW 12 40081771 missense probably damaging 0.98
R0539:Scin UTSW 12 40081766 missense possibly damaging 0.65
R0591:Scin UTSW 12 40080930 critical splice donor site probably null
R0718:Scin UTSW 12 40079607 missense probably damaging 1.00
R1473:Scin UTSW 12 40077502 missense probably benign
R1566:Scin UTSW 12 40081674 missense probably benign 0.17
R1570:Scin UTSW 12 40084381 splice site probably benign
R1624:Scin UTSW 12 40127930 missense probably benign
R1827:Scin UTSW 12 40068923 missense possibly damaging 0.88
R1836:Scin UTSW 12 40124698 missense probably damaging 1.00
R1985:Scin UTSW 12 40133908 critical splice donor site probably null
R2042:Scin UTSW 12 40077510 missense possibly damaging 0.96
R2061:Scin UTSW 12 40080948 missense probably damaging 1.00
R2147:Scin UTSW 12 40080985 missense probably benign 0.00
R2232:Scin UTSW 12 40068931 missense probably damaging 1.00
R2504:Scin UTSW 12 40081706 missense probably benign 0.02
R4781:Scin UTSW 12 40081764 missense possibly damaging 0.59
R4898:Scin UTSW 12 40104932 missense probably benign
R4914:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4915:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4916:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4917:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4918:Scin UTSW 12 40069374 missense possibly damaging 0.79
R5068:Scin UTSW 12 40124700 missense probably damaging 1.00
R5098:Scin UTSW 12 40077542 nonsense probably null
R5233:Scin UTSW 12 40077559 missense probably benign
R5564:Scin UTSW 12 40124569 missense probably benign
R5677:Scin UTSW 12 40063259 missense probably damaging 1.00
R5967:Scin UTSW 12 40077538 missense probably benign 0.35
R6027:Scin UTSW 12 40077516 missense probably damaging 1.00
R6130:Scin UTSW 12 40069436 missense probably benign 0.01
R6134:Scin UTSW 12 40060579 missense probably damaging 1.00
R6135:Scin UTSW 12 40079808 missense possibly damaging 0.80
R6439:Scin UTSW 12 40068946 missense probably damaging 0.99
R6613:Scin UTSW 12 40079715 missense probably benign 0.04
R7127:Scin UTSW 12 40105072 missense possibly damaging 0.69
R7234:Scin UTSW 12 40080958 nonsense probably null
R7431:Scin UTSW 12 40133922 missense probably damaging 1.00
R7609:Scin UTSW 12 40124589 missense probably damaging 1.00
R7665:Scin UTSW 12 40069415 missense probably damaging 1.00
R7704:Scin UTSW 12 40124688 missense possibly damaging 0.93
X0018:Scin UTSW 12 40069433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCCTATACACTGACCTCCAC -3'
(R):5'- GGAATGTTGCCATTCTCCCATTGC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- gccttacttagattctgagattagac -3'
Posted On2013-07-30