Incidental Mutation 'R0668:Gm10549'
ID62113
Institutional Source Beutler Lab
Gene Symbol Gm10549
Ensembl Gene ENSMUSG00000073610
Gene Namepredicted gene 10549
Synonyms
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0668 (G1)
Quality Score150
Status Not validated
Chromosome18
Chromosomal Location33464163-33472448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33470850 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000095236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097634]
Predicted Effect unknown
Transcript: ENSMUST00000097634
AA Change: T129A
SMART Domains Protein: ENSMUSP00000095236
Gene: ENSMUSG00000073610
AA Change: T129A

DomainStartEndE-ValueType
low complexity region 56 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Gm10549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Gm10549 APN 18 33464250 unclassified probably benign
R0374:Gm10549 UTSW 18 33464182 unclassified probably benign
R1806:Gm10549 UTSW 18 33470788 missense unknown
R4214:Gm10549 UTSW 18 33464477 splice site probably null
R4826:Gm10549 UTSW 18 33470785 missense unknown
R5747:Gm10549 UTSW 18 33464305 unclassified probably benign
R5748:Gm10549 UTSW 18 33464305 unclassified probably benign
R5766:Gm10549 UTSW 18 33464305 unclassified probably benign
R5796:Gm10549 UTSW 18 33464305 unclassified probably benign
R6101:Gm10549 UTSW 18 33464305 unclassified probably benign
R6129:Gm10549 UTSW 18 33464305 unclassified probably benign
R6130:Gm10549 UTSW 18 33464305 unclassified probably benign
R6218:Gm10549 UTSW 18 33464305 unclassified probably benign
R6219:Gm10549 UTSW 18 33464305 unclassified probably benign
R6220:Gm10549 UTSW 18 33464305 unclassified probably benign
R6283:Gm10549 UTSW 18 33464305 unclassified probably benign
R6298:Gm10549 UTSW 18 33464305 unclassified probably benign
R6299:Gm10549 UTSW 18 33464305 unclassified probably benign
R6309:Gm10549 UTSW 18 33464305 unclassified probably benign
R6321:Gm10549 UTSW 18 33464305 unclassified probably benign
R6322:Gm10549 UTSW 18 33464305 unclassified probably benign
R6327:Gm10549 UTSW 18 33464305 unclassified probably benign
R6337:Gm10549 UTSW 18 33464305 unclassified probably benign
R6405:Gm10549 UTSW 18 33464305 unclassified probably benign
R6420:Gm10549 UTSW 18 33464305 unclassified probably benign
R6492:Gm10549 UTSW 18 33464305 unclassified probably benign
R6494:Gm10549 UTSW 18 33464305 unclassified probably benign
R6505:Gm10549 UTSW 18 33464305 unclassified probably benign
R7173:Gm10549 UTSW 18 33464409 missense unknown
R7724:Gm10549 UTSW 18 33470859 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTGCTCCTGCTGGAATG -3'
(R):5'- ATGTGCTACAGGCCCTTTGCTC -3'

Sequencing Primer
(F):5'- ttatatgctgaagtccagaccc -3'
(R):5'- ACAGGCCCTTTGCTCTTGTG -3'
Posted On2013-07-30