Incidental Mutation 'R0669:Ptpn13'
ID62128
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R0669 (G1)
Quality Score110
Status Validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103556109 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1336 (T1336A)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957]
Predicted Effect probably benign
Transcript: ENSMUST00000048957
AA Change: T1336A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: T1336A

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7253:Ptpn13 UTSW 5 103565284 missense possibly damaging 0.68
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
R7391:Ptpn13 UTSW 5 103540981 missense probably damaging 1.00
R7451:Ptpn13 UTSW 5 103527095 missense probably benign 0.16
R7614:Ptpn13 UTSW 5 103501465 missense probably benign 0.13
R7652:Ptpn13 UTSW 5 103529712 missense probably benign 0.12
R7655:Ptpn13 UTSW 5 103540983 missense probably benign 0.00
R7656:Ptpn13 UTSW 5 103540983 missense probably benign 0.00
R7683:Ptpn13 UTSW 5 103565152 missense probably benign 0.01
R7734:Ptpn13 UTSW 5 103561962 missense probably damaging 1.00
R7794:Ptpn13 UTSW 5 103492224 missense probably benign 0.06
RF017:Ptpn13 UTSW 5 103593580 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GGTCCAGCTTCACTTTCTGAGTGTC -3'
(R):5'- GTGTCCCATCTGAGCCACTGTAAC -3'

Sequencing Primer
(F):5'- ATGAGTGATTCCTGACCTGACAG -3'
(R):5'- TCAGCTAACAGGTTGGGCTAC -3'
Posted On2013-07-30