Incidental Mutation 'R0669:Olfr293'
ID62134
Institutional Source Beutler Lab
Gene Symbol Olfr293
Ensembl Gene ENSMUSG00000063394
Gene Nameolfactory receptor 293
SynonymsGA_x6K02T2NHDJ-9457744-9456734, MOR221-3
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0669 (G1)
Quality Score111
Status Validated
Chromosome7
Chromosomal Location86649061-86666045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86664336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 225 (I225V)
Ref Sequence ENSEMBL: ENSMUSP00000149959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081474] [ENSMUST00000214401] [ENSMUST00000215280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081474
AA Change: I225V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080193
Gene: ENSMUSG00000063394
AA Change: I225V

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.1e-45 PFAM
Pfam:7tm_1 45 295 1.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214401
AA Change: I225V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215280
AA Change: I225V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Olfr293
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02478:Olfr293 APN 7 86664136 missense probably damaging 0.97
IGL02659:Olfr293 APN 7 86664081 missense probably benign 0.06
IGL02730:Olfr293 APN 7 86664067 missense probably damaging 0.98
IGL02959:Olfr293 APN 7 86664529 missense probably damaging 0.98
R0045:Olfr293 UTSW 7 86664340 missense possibly damaging 0.90
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0152:Olfr293 UTSW 7 86664511 missense probably damaging 1.00
R0942:Olfr293 UTSW 7 86664106 missense probably damaging 0.98
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R1656:Olfr293 UTSW 7 86664123 missense probably benign 0.04
R2010:Olfr293 UTSW 7 86664603 missense probably benign
R2056:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2059:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2105:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R4166:Olfr293 UTSW 7 86664394 missense probably damaging 1.00
R4303:Olfr293 UTSW 7 86663955 missense probably benign 0.16
R4531:Olfr293 UTSW 7 86664271 missense probably benign 0.02
R4808:Olfr293 UTSW 7 86663938 missense probably benign 0.00
R5748:Olfr293 UTSW 7 86664085 missense possibly damaging 0.61
R5937:Olfr293 UTSW 7 86664476 missense probably benign 0.00
R6178:Olfr293 UTSW 7 86664611 missense probably benign 0.45
R6766:Olfr293 UTSW 7 86664085 missense probably damaging 0.98
R7315:Olfr293 UTSW 7 86664237 missense probably damaging 0.99
R7585:Olfr293 UTSW 7 86664672 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGCCATATGCAAGCCTCTCCTC -3'
(R):5'- AGAACACAGAAAGTGTCATCTCCTGAAC -3'

Sequencing Primer
(F):5'- TGCATTCAGATGACACTGGC -3'
(R):5'- GAAAGTGTCATCTCCTGAACTACTTC -3'
Posted On2013-07-30