Mutagenetix > Incidental Mutations

Incidental Mutation 'R0669:Numa1'

62135

Institutional Source

Beutler Lab

Gene Symbol

Numa1

Ensembl Gene

ENSMUSG00000066306

Gene Name

nuclear mitotic apparatus protein 1

Synonyms

6720401E04Rik

MMRRC Submission

038854-MU

Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0669 (G1)

Quality Score

101

Status

Validated

Chromosome

Chromosomal Location

101934111-102014964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 101999677 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 872 (I872L)

Ref Sequence

ENSEMBL: ENSMUSP00000148098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000163183] [ENSMUST00000209639] [ENSMUST00000210475] [ENSMUST00000210679] [ENSMUST00000211272]

Predicted Effect

probably benign
Transcript: ENSMUST00000084852
AA Change: I872L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: I872L

Domain	Start	End	E-Value	Type
low complexity region	187	201	N/A	INTRINSIC
coiled coil region	211	249	N/A	INTRINSIC
coiled coil region	274	818	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
internal_repeat_1	910	933	6.03e-6	PROSPERO
internal_repeat_2	911	951	2.35e-5	PROSPERO
low complexity region	979	992	N/A	INTRINSIC
low complexity region	1002	1018	N/A	INTRINSIC
low complexity region	1063	1081	N/A	INTRINSIC
internal_repeat_5	1094	1116	4.63e-5	PROSPERO
low complexity region	1130	1138	N/A	INTRINSIC
low complexity region	1220	1233	N/A	INTRINSIC
low complexity region	1271	1289	N/A	INTRINSIC
low complexity region	1364	1374	N/A	INTRINSIC
coiled coil region	1464	1681	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
internal_repeat_3	1718	1755	4.63e-5	PROSPERO
internal_repeat_4	1777	1819	4.63e-5	PROSPERO
internal_repeat_3	1800	1842	4.63e-5	PROSPERO
internal_repeat_4	1811	1854	4.63e-5	PROSPERO
low complexity region	1859	1875	N/A	INTRINSIC
PDB:3RO2\|B	1881	1908	3e-13	PDB
internal_repeat_2	1938	1977	2.35e-5	PROSPERO
internal_repeat_5	1973	1995	4.63e-5	PROSPERO
internal_repeat_1	2020	2043	6.03e-6	PROSPERO
low complexity region	2073	2085	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163183

SMART Domains

Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306

Domain	Start	End	E-Value	Type
coiled coil region	7	73	N/A	INTRINSIC
low complexity region	150	160	N/A	INTRINSIC
SCOP:d1fxkc_	164	290	7e-3	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	506	522	N/A	INTRINSIC
PDB:3RO2\|B	528	555	2e-10	PDB
low complexity region	720	732	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209583

Predicted Effect

probably benign
Transcript: ENSMUST00000209639
AA Change: I872L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210353

Predicted Effect

probably benign
Transcript: ENSMUST00000210475
AA Change: I872L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210679

Predicted Effect

probably benign
Transcript: ENSMUST00000211272

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]

Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	A	11: 72,198,845	H71L	possibly damaging	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abcb11	C	A	2: 69,329,318	V10L	probably benign	Het
Abcb9	T	C	5: 124,062,887	T689A	probably damaging	Het
Adam22	A	G	5: 8,143,036		probably benign	Het
Adamts5	A	G	16: 85,899,726	I181T	probably benign	Het
Adamts9	A	T	6: 92,880,957	V231D	probably damaging	Het
Angptl6	C	T	9: 20,876,527	V197M	probably damaging	Het
Atp6v1c1	T	C	15: 38,677,528	V99A	probably benign	Het
Cacna2d3	A	G	14: 29,467,949	V110A	probably benign	Het
Ccdc32	A	G	2: 119,019,167		probably benign	Het
Cela3b	T	C	4: 137,428,530	H22R	probably benign	Het
Cep44	T	C	8: 56,540,973	T190A	possibly damaging	Het
Chsy1	T	C	7: 66,171,687	C557R	probably damaging	Het
Cntd1	A	G	11: 101,287,498	T308A	probably damaging	Het
Cutal	T	C	2: 34,885,866		probably benign	Het
Dgcr14	T	C	16: 17,907,555	Y221C	probably damaging	Het
Dna2	A	G	10: 62,956,989	D261G	probably damaging	Het
Dnhd1	T	A	7: 105,693,704	S1418R	probably benign	Het
Dnpep	A	G	1: 75,311,778		probably benign	Het
Dock7	A	T	4: 98,987,479	Y1075N	probably benign	Het
Eif2s1	C	T	12: 78,881,238		probably benign	Het
Fam69b	A	G	2: 26,634,866	T93A	probably benign	Het
Fer1l6	T	C	15: 58,553,724		probably null	Het
Gm5592	T	C	7: 41,155,830		probably benign	Het
Ipp	A	G	4: 116,537,876	Y536C	probably damaging	Het
Krt72	T	C	15: 101,778,305	E402G	probably damaging	Het
Lamb3	T	C	1: 193,332,330	L599P	probably damaging	Het
Lingo2	T	A	4: 35,709,120	T287S	probably benign	Het
Lipo3	T	A	19: 33,559,625	T232S	probably benign	Het
Lrrc63	G	A	14: 75,126,110	H194Y	probably benign	Het
Map3k13	A	G	16: 21,906,524	T416A	probably benign	Het
Mcm3	A	T	1: 20,804,929		probably null	Het
Mms22l	T	C	4: 24,517,223	V258A	probably benign	Het
Mrpl46	A	T	7: 78,782,883	L49*	probably null	Het
Mrs2	T	C	13: 24,993,759	T369A	possibly damaging	Het
Mtrf1	T	A	14: 79,419,268	Y403*	probably null	Het
Muc20	G	A	16: 32,794,480	P176S	unknown	Het
Mup21	C	T	4: 62,150,727	C9Y	unknown	Het
Mup-ps21	A	T	4: 62,030,770		noncoding transcript	Het
Mybph	T	G	1: 134,197,343		probably null	Het
Mypn	A	G	10: 63,134,923		probably benign	Het
Nav2	T	C	7: 49,408,683	S124P	probably damaging	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Olfr1206	A	T	2: 88,864,928	M108L	probably benign	Het
Olfr13	C	T	6: 43,174,004	T6I	probably benign	Het
Olfr293	A	G	7: 86,664,336	I225V	possibly damaging	Het
Olfr472	T	A	7: 107,903,239	I174K	probably damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pcdhb9	A	T	18: 37,402,255	N434I	probably damaging	Het
Pigq	A	T	17: 25,936,762		probably null	Het
Plxna2	T	G	1: 194,788,837	V972G	probably damaging	Het
Psma3	G	A	12: 70,988,495		probably benign	Het
Ptpn13	A	G	5: 103,556,109	T1336A	probably benign	Het
Rdh7	T	C	10: 127,884,729	D258G	probably benign	Het
Serpinb6c	A	G	13: 33,899,269	I54T	probably damaging	Het
Sh2d7	A	T	9: 54,541,349	Y218F	probably benign	Het
Slc12a8	A	T	16: 33,550,904	I137F	possibly damaging	Het
Smarca2	T	C	19: 26,706,200	V1153A	possibly damaging	Het
Smc6	A	T	12: 11,289,164	I334L	probably benign	Het
Sorcs1	A	G	19: 50,241,942		probably benign	Het
Taar8c	A	G	10: 24,101,503	L137P	probably damaging	Het
Tcam1	A	T	11: 106,285,426	D326V	possibly damaging	Het
Telo2	A	T	17: 25,105,823	V461D	probably benign	Het
Tmprss7	A	T	16: 45,677,962	C351*	probably null	Het
Trim66	T	A	7: 109,454,992		probably benign	Het
Ube2d1	G	T	10: 71,262,110	H32N	probably benign	Het
Ubp1	T	C	9: 113,964,668		probably benign	Het
Vma21	C	T	X: 71,820,157	T81M	probably damaging	Het
Vmn1r113	T	C	7: 20,787,420	S46P	probably benign	Het
Wars	T	C	12: 108,866,018	S374G	probably benign	Het
Wbp1	T	C	6: 83,119,345	D277G	possibly damaging	Het
Zfp939	C	A	7: 39,473,785		noncoding transcript	Het

Other mutations in Numa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Numa1	APN	7	102013286	missense	possibly damaging	0.95
IGL00819:Numa1	APN	7	101992710	missense	possibly damaging	0.90
IGL01103:Numa1	APN	7	102001571	missense	probably benign	0.01
IGL01153:Numa1	APN	7	101994744	missense	probably damaging	1.00
IGL01954:Numa1	APN	7	101996093	nonsense	probably null
IGL02114:Numa1	APN	7	102011876	unclassified	probably benign
IGL02245:Numa1	APN	7	102000394	missense	probably benign	0.02
IGL02259:Numa1	APN	7	101987748	missense	possibly damaging	0.93
IGL02313:Numa1	APN	7	102000232	nonsense	probably null
IGL02316:Numa1	APN	7	102001370	missense	probably damaging	1.00
IGL02386:Numa1	APN	7	102007532	missense	probably benign	0.00
IGL02517:Numa1	APN	7	102012009	missense	probably benign	0.01
IGL02529:Numa1	APN	7	101999953	unclassified	probably null
IGL02664:Numa1	APN	7	101998902	missense	possibly damaging	0.83
IGL02721:Numa1	APN	7	101999911	missense	probably benign	0.01
IGL02816:Numa1	APN	7	101996100	missense	probably damaging	1.00
IGL03126:Numa1	APN	7	102000667	nonsense	probably null
Meltdown	UTSW	7	101990571	critical splice acceptor site	probably null
1mM(1):Numa1	UTSW	7	101994715	missense	probably benign	0.06
PIT4651001:Numa1	UTSW	7	102013934	missense	probably damaging	0.97
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0548:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0554:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0592:Numa1	UTSW	7	102013897	missense	probably benign
R0856:Numa1	UTSW	7	101998948	missense	probably damaging	1.00
R1072:Numa1	UTSW	7	102001150	unclassified	probably null
R1776:Numa1	UTSW	7	102011050	missense	probably damaging	1.00
R1898:Numa1	UTSW	7	101992720	critical splice donor site	probably null
R1969:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1970:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1971:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R2180:Numa1	UTSW	7	101999990	missense	probably benign	0.00
R2256:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2257:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2508:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R2958:Numa1	UTSW	7	102009495	missense	possibly damaging	0.92
R4210:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4211:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4643:Numa1	UTSW	7	102000665	unclassified	probably null
R4783:Numa1	UTSW	7	102013566	missense	probably damaging	1.00
R4823:Numa1	UTSW	7	101996037	missense	probably damaging	1.00
R4908:Numa1	UTSW	7	102012805	missense	probably damaging	1.00
R4934:Numa1	UTSW	7	102010857	missense	probably benign	0.32
R4981:Numa1	UTSW	7	101992674	missense	probably damaging	1.00
R5120:Numa1	UTSW	7	101977437	missense	probably damaging	0.99
R5122:Numa1	UTSW	7	102013769	missense	probably damaging	1.00
R5210:Numa1	UTSW	7	101999981	missense	probably benign	0.03
R5230:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R5547:Numa1	UTSW	7	102013930	missense	probably damaging	1.00
R5861:Numa1	UTSW	7	102009287	splice site	probably null
R6006:Numa1	UTSW	7	101992719	critical splice donor site	probably null
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6295:Numa1	UTSW	7	102000767	missense	probably benign	0.03
R6322:Numa1	UTSW	7	102000920	missense	probably damaging	1.00
R6413:Numa1	UTSW	7	101990571	critical splice acceptor site	probably null
R6786:Numa1	UTSW	7	101992638	missense	probably benign	0.05
R7218:Numa1	UTSW	7	102000910	missense	probably benign	0.02
R7312:Numa1	UTSW	7	101990599	missense	possibly damaging	0.92
R7374:Numa1	UTSW	7	102009128	missense	probably benign	0.00
R7626:Numa1	UTSW	7	101999423	missense	probably benign	0.42
R7769:Numa1	UTSW	7	101999000	missense	possibly damaging	0.77
R7830:Numa1	UTSW	7	101999285	missense	probably benign	0.03
RF013:Numa1	UTSW	7	101999780	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998331	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998402	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- AGGCTCATCAGGCTGAGACTGAAG -3'
(R):5'- AAGTGAGGCTGTTTCCTGCTGC -3'

Sequencing Primer
(F):5'- TGAGACTGAAGCCTTGCG -3'
(R):5'- CTCACCTGCCTTGAGCAC -3'

Posted On

2013-07-30