Incidental Mutation 'R0669:Sh2d7'
ID62141
Institutional Source Beutler Lab
Gene Symbol Sh2d7
Ensembl Gene ENSMUSG00000046460
Gene NameSH2 domain containing 7
Synonyms
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0669 (G1)
Quality Score125
Status Validated
Chromosome9
Chromosomal Location54538984-54545020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54541349 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 218 (Y218F)
Ref Sequence ENSEMBL: ENSMUSP00000113298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041901] [ENSMUST00000060242] [ENSMUST00000118413]
Predicted Effect probably benign
Transcript: ENSMUST00000041901
SMART Domains Protein: ENSMUSP00000038527
Gene: ENSMUSG00000037493

DomainStartEndE-ValueType
EFh 73 98 8.33e1 SMART
EFh 107 135 5.38e0 SMART
EFh 148 176 3.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060242
AA Change: Y218F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053690
Gene: ENSMUSG00000046460
AA Change: Y218F

DomainStartEndE-ValueType
Blast:SH2 1 51 7e-6 BLAST
low complexity region 165 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118413
AA Change: Y218F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113298
Gene: ENSMUSG00000046460
AA Change: Y218F

DomainStartEndE-ValueType
Blast:SH2 1 51 7e-6 BLAST
low complexity region 165 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157176
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Sh2d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Sh2d7 APN 9 54541231 missense probably benign 0.01
IGL01906:Sh2d7 APN 9 54539466 utr 5 prime probably benign
IGL02724:Sh2d7 APN 9 54540821 missense probably benign 0.13
R0482:Sh2d7 UTSW 9 54541037 missense probably benign 0.00
R1187:Sh2d7 UTSW 9 54541187 missense probably benign 0.40
R5809:Sh2d7 UTSW 9 54539576 missense probably benign 0.01
R7286:Sh2d7 UTSW 9 54540902 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGTCCTCCTCTGAAGCAAGCTC -3'
(R):5'- ACAGTAAGCAAGCTGCTCGTTCC -3'

Sequencing Primer
(F):5'- CTACAGATACCTACCACCTTGTTGAG -3'
(R):5'- cctcagactcacagaaaccc -3'
Posted On2013-07-30