Incidental Mutation 'R0669:Cacna2d3'
ID 62158
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha2delta3, alpha 2 delta-3
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0669 (G1)
Quality Score 204
Status Validated
Chromosome 14
Chromosomal Location 28904943-29721864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29467949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567]
AlphaFold Q9Z1L5
Predicted Effect probably benign
Transcript: ENSMUST00000022567
AA Change: V110A

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: V110A

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Meta Mutation Damage Score 0.0957 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 29097815 missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28969263 missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29333778 missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29347014 missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28905311 missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGAGGACTGCTACCCTCATCCAAC -3'
(R):5'- GACCTTTGATTCCCGAGTTACACCC -3'

Sequencing Primer
(F):5'- TCATCCAACATGAGAGAGATATGC -3'
(R):5'- CCGAGTTACACCCTTTCTAAATAAG -3'
Posted On 2013-07-30