Incidental Mutation 'R0649:Cln5'
ID62177
Institutional Source Beutler Lab
Gene Symbol Cln5
Ensembl Gene ENSMUSG00000022125
Gene Nameceroid-lipofuscinosis, neuronal 5
SynonymsA730075N08Rik
MMRRC Submission 038834-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R0649 (G1)
Quality Score115
Status Not validated
Chromosome14
Chromosomal Location103070216-103077628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103071761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 84 (I84V)
Ref Sequence ENSEMBL: ENSMUSP00000022721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022721]
Predicted Effect probably benign
Transcript: ENSMUST00000022721
AA Change: I84V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022721
Gene: ENSMUSG00000022125
AA Change: I84V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:CLN5 34 332 9e-169 PFAM
Predicted Effect silent
Transcript: ENSMUST00000227117
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants showed loss of vision and accumulation of autofluorescent storage material in the central nervous system. Loss of a subset of GABAergic interneurons was seen in several brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 G A 9: 44,278,033 T389M probably benign Het
Nlrp3 G T 11: 59,548,542 C315F possibly damaging Het
Rcn2 A G 9: 56,058,135 D296G probably damaging Het
Ttn T C 2: 76,747,844 E24235G probably damaging Het
Other mutations in Cln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Cln5 APN 14 103076032 missense possibly damaging 0.64
IGL02218:Cln5 APN 14 103075840 unclassified probably null
PIT4480001:Cln5 UTSW 14 103071778 nonsense probably null
R2043:Cln5 UTSW 14 103075944 missense probably damaging 1.00
R2313:Cln5 UTSW 14 103071746 nonsense probably null
R3829:Cln5 UTSW 14 103073359 missense probably damaging 0.97
R5486:Cln5 UTSW 14 103076194 missense probably damaging 0.98
R6265:Cln5 UTSW 14 103073227 missense probably damaging 1.00
R6361:Cln5 UTSW 14 103076201 missense probably benign 0.05
R7361:Cln5 UTSW 14 103075903 missense probably damaging 1.00
R7869:Cln5 UTSW 14 103076065 missense probably damaging 1.00
R7952:Cln5 UTSW 14 103076065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGTTCTCTTTCTCACCAGGCG -3'
(R):5'- ATGCTCCTCATGGCAGCCTTTG -3'

Sequencing Primer
(F):5'- GCGCTTCTCTTTCCGTCC -3'
(R):5'- gacacccagcagcctcc -3'
Posted On2013-07-30