Incidental Mutation 'R0650:Ankar'
ID 62178
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission 038835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R0650 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 72682139-72739738 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 72695380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably benign
Transcript: ENSMUST00000053499
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
Predicted Effect probably benign
Transcript: ENSMUST00000212573
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 68,989,391 (GRCm39) S96G unknown Het
4930447C04Rik T C 12: 72,956,830 (GRCm39) D120G probably damaging Het
Actmap A T 7: 26,902,072 (GRCm39) H233L probably damaging Het
Adgrg5 T A 8: 95,660,785 (GRCm39) probably null Het
Afg3l2 G T 18: 67,548,627 (GRCm39) H534Q possibly damaging Het
Arid2 T A 15: 96,299,930 (GRCm39) F1814L possibly damaging Het
Asb15 C T 6: 24,566,163 (GRCm39) A372V probably damaging Het
Atg16l1 A T 1: 87,709,421 (GRCm39) D403V possibly damaging Het
Bnc2 T C 4: 84,211,433 (GRCm39) D407G probably benign Het
Ccdc121 T C 5: 31,643,312 (GRCm39) probably benign Het
Cdan1 A G 2: 120,556,526 (GRCm39) V633A probably benign Het
Cfap46 T C 7: 139,185,571 (GRCm39) Y2482C unknown Het
Chd8 T C 14: 52,439,761 (GRCm39) E964G probably benign Het
Cyp2s1 A G 7: 25,508,683 (GRCm39) V253A probably damaging Het
Depdc1b A G 13: 108,460,443 (GRCm39) N18D probably damaging Het
Fis1 T A 5: 136,991,048 (GRCm39) V4E probably damaging Het
Gba2 T A 4: 43,570,424 (GRCm39) probably null Het
Gm2381 C T 7: 42,469,504 (GRCm39) G207R probably damaging Het
Gpr89 T A 3: 96,804,640 (GRCm39) probably benign Het
Gtf2i A G 5: 134,290,691 (GRCm39) probably benign Het
Herc2 T G 7: 55,762,958 (GRCm39) S896A probably damaging Het
Huwe1 T C X: 150,659,309 (GRCm39) S921P probably damaging Het
Iqgap1 T A 7: 80,386,143 (GRCm39) K936I probably damaging Het
Kcna4 T A 2: 107,125,927 (GRCm39) Y220* probably null Het
Krt18 A G 15: 101,937,920 (GRCm39) D139G possibly damaging Het
Krt87 T C 15: 101,384,921 (GRCm39) N392D probably damaging Het
L3mbtl4 G A 17: 69,081,286 (GRCm39) C558Y probably damaging Het
Lamc2 T A 1: 153,019,622 (GRCm39) I440F possibly damaging Het
Lrrc28 T C 7: 67,267,833 (GRCm39) N98S probably damaging Het
Lrrk1 G A 7: 65,942,084 (GRCm39) A718V probably damaging Het
Mrgprx2 T C 7: 48,132,666 (GRCm39) I51V probably damaging Het
Myt1 A T 2: 181,424,408 (GRCm39) R25* probably null Het
Npdc1 C T 2: 25,298,021 (GRCm39) T199I probably benign Het
Nup98 T A 7: 101,801,660 (GRCm39) Y755F probably damaging Het
Or51q1c A G 7: 103,652,446 (GRCm39) probably null Het
Or5p69 T A 7: 107,966,996 (GRCm39) C100S probably damaging Het
Or5p76 G T 7: 108,122,289 (GRCm39) N289K probably damaging Het
Or8g22 T A 9: 38,957,996 (GRCm39) M240L probably benign Het
Osgin1 A T 8: 120,172,211 (GRCm39) Y335F probably damaging Het
Pde10a A T 17: 9,161,797 (GRCm39) I493F probably damaging Het
Pdgfrb A G 18: 61,212,780 (GRCm39) I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 (GRCm39) probably benign Het
Pidd1 A T 7: 141,020,726 (GRCm39) L457* probably null Het
Pik3c2a A G 7: 115,945,482 (GRCm39) probably benign Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Plcg1 C T 2: 160,595,283 (GRCm39) probably benign Het
Prr13 A C 15: 102,370,650 (GRCm39) *138C probably null Het
Prrc2b T C 2: 32,119,267 (GRCm39) probably benign Het
Psph T C 5: 129,868,633 (GRCm39) probably benign Het
Ripor1 A G 8: 106,344,746 (GRCm39) probably benign Het
Scg3 A G 9: 75,576,617 (GRCm39) S253P probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Sgk1 A G 10: 21,758,556 (GRCm39) N7D probably damaging Het
Skor2 T C 18: 76,964,255 (GRCm39) F940L probably benign Het
Slbp T C 5: 33,802,833 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Susd5 A T 9: 113,911,603 (GRCm39) H171L possibly damaging Het
Sybu T C 15: 44,536,664 (GRCm39) E354G probably benign Het
Synpo T C 18: 60,735,412 (GRCm39) N845D possibly damaging Het
Tdrd6 A T 17: 43,939,050 (GRCm39) I666N probably damaging Het
Tm9sf4 T C 2: 153,029,285 (GRCm39) I111T probably benign Het
Tnc T C 4: 63,926,971 (GRCm39) T852A probably benign Het
Tnfrsf10b T A 14: 70,013,625 (GRCm39) I185K probably damaging Het
Tnks1bp1 A G 2: 84,892,974 (GRCm39) E305G possibly damaging Het
Tnrc6b T C 15: 80,668,959 (GRCm39) V22A probably benign Het
Ttn A T 2: 76,598,956 (GRCm39) F19319Y probably damaging Het
Ubr5 T C 15: 38,031,051 (GRCm39) probably benign Het
Ugt2b5 T A 5: 87,287,627 (GRCm39) Q191L probably benign Het
Urod T C 4: 116,848,473 (GRCm39) T300A probably benign Het
Vmn1r213 A G 13: 23,195,564 (GRCm39) probably benign Het
Znfx1 G A 2: 166,889,574 (GRCm39) Q723* probably null Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72,729,290 (GRCm39) missense probably damaging 1.00
IGL01013:Ankar APN 1 72,690,148 (GRCm39) missense possibly damaging 0.90
IGL01135:Ankar APN 1 72,704,378 (GRCm39) missense probably benign 0.28
IGL01824:Ankar APN 1 72,690,886 (GRCm39) missense probably benign 0.40
IGL01885:Ankar APN 1 72,697,862 (GRCm39) missense probably damaging 1.00
IGL01932:Ankar APN 1 72,738,146 (GRCm39) missense probably benign 0.25
IGL02143:Ankar APN 1 72,697,808 (GRCm39) critical splice donor site probably null
IGL02326:Ankar APN 1 72,705,514 (GRCm39) missense probably damaging 1.00
IGL02445:Ankar APN 1 72,705,524 (GRCm39) missense probably benign 0.05
IGL02606:Ankar APN 1 72,729,444 (GRCm39) missense possibly damaging 0.61
IGL02635:Ankar APN 1 72,691,590 (GRCm39) missense possibly damaging 0.93
IGL02680:Ankar APN 1 72,709,275 (GRCm39) missense probably damaging 1.00
IGL02704:Ankar APN 1 72,691,502 (GRCm39) missense possibly damaging 0.88
IGL03086:Ankar APN 1 72,682,437 (GRCm39) missense possibly damaging 0.84
IGL03269:Ankar APN 1 72,704,360 (GRCm39) missense probably damaging 0.99
IGL03368:Ankar APN 1 72,714,972 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0488:Ankar UTSW 1 72,697,891 (GRCm39) missense probably damaging 1.00
R1121:Ankar UTSW 1 72,690,822 (GRCm39) splice site probably null
R1163:Ankar UTSW 1 72,727,864 (GRCm39) missense possibly damaging 0.82
R1300:Ankar UTSW 1 72,682,323 (GRCm39) missense probably benign 0.00
R1309:Ankar UTSW 1 72,713,163 (GRCm39) missense possibly damaging 0.59
R1366:Ankar UTSW 1 72,737,808 (GRCm39) missense probably damaging 1.00
R1456:Ankar UTSW 1 72,704,277 (GRCm39) missense probably benign 0.34
R1495:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R1583:Ankar UTSW 1 72,718,714 (GRCm39) splice site probably benign
R1635:Ankar UTSW 1 72,689,297 (GRCm39) missense probably damaging 0.99
R1975:Ankar UTSW 1 72,697,600 (GRCm39) missense possibly damaging 0.95
R2036:Ankar UTSW 1 72,705,689 (GRCm39) nonsense probably null
R2511:Ankar UTSW 1 72,697,853 (GRCm39) missense probably damaging 1.00
R2965:Ankar UTSW 1 72,714,979 (GRCm39) missense probably benign 0.00
R3404:Ankar UTSW 1 72,682,252 (GRCm39) nonsense probably null
R3417:Ankar UTSW 1 72,698,135 (GRCm39) critical splice donor site probably null
R4072:Ankar UTSW 1 72,727,751 (GRCm39) missense probably damaging 1.00
R4231:Ankar UTSW 1 72,697,701 (GRCm39) missense probably benign 0.23
R4447:Ankar UTSW 1 72,726,948 (GRCm39) missense possibly damaging 0.60
R4632:Ankar UTSW 1 72,686,343 (GRCm39) missense probably benign 0.01
R4720:Ankar UTSW 1 72,738,170 (GRCm39) missense possibly damaging 0.55
R4754:Ankar UTSW 1 72,737,853 (GRCm39) missense probably damaging 1.00
R4884:Ankar UTSW 1 72,737,966 (GRCm39) missense probably damaging 0.97
R5068:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5069:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5070:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5189:Ankar UTSW 1 72,697,573 (GRCm39) missense probably benign 0.01
R5247:Ankar UTSW 1 72,719,343 (GRCm39) missense probably benign 0.08
R5322:Ankar UTSW 1 72,729,545 (GRCm39) splice site probably null
R5345:Ankar UTSW 1 72,709,310 (GRCm39) missense possibly damaging 0.94
R5864:Ankar UTSW 1 72,698,324 (GRCm39) missense probably benign 0.00
R5976:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R6003:Ankar UTSW 1 72,738,046 (GRCm39) missense probably damaging 1.00
R6042:Ankar UTSW 1 72,713,213 (GRCm39) nonsense probably null
R6296:Ankar UTSW 1 72,682,417 (GRCm39) missense probably damaging 1.00
R6488:Ankar UTSW 1 72,720,967 (GRCm39) critical splice donor site probably null
R6885:Ankar UTSW 1 72,682,195 (GRCm39) missense unknown
R6985:Ankar UTSW 1 72,697,641 (GRCm39) missense probably damaging 1.00
R7060:Ankar UTSW 1 72,695,272 (GRCm39) missense probably benign 0.18
R7099:Ankar UTSW 1 72,682,452 (GRCm39) missense probably damaging 0.99
R7194:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7221:Ankar UTSW 1 72,689,390 (GRCm39) missense probably damaging 1.00
R7222:Ankar UTSW 1 72,705,514 (GRCm39) missense probably damaging 0.99
R7258:Ankar UTSW 1 72,690,886 (GRCm39) missense probably benign 0.40
R7303:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7308:Ankar UTSW 1 72,690,953 (GRCm39) nonsense probably null
R7384:Ankar UTSW 1 72,697,624 (GRCm39) missense probably benign 0.00
R7424:Ankar UTSW 1 72,719,217 (GRCm39) missense probably damaging 1.00
R7464:Ankar UTSW 1 72,738,053 (GRCm39) missense possibly damaging 0.94
R7525:Ankar UTSW 1 72,727,800 (GRCm39) missense probably benign 0.18
R7618:Ankar UTSW 1 72,714,925 (GRCm39) missense probably benign 0.22
R7659:Ankar UTSW 1 72,729,294 (GRCm39) missense possibly damaging 0.95
R7974:Ankar UTSW 1 72,738,138 (GRCm39) nonsense probably null
R8008:Ankar UTSW 1 72,705,643 (GRCm39) missense possibly damaging 0.47
R8119:Ankar UTSW 1 72,686,160 (GRCm39) missense probably damaging 0.98
R8244:Ankar UTSW 1 72,690,183 (GRCm39) missense probably benign
R8342:Ankar UTSW 1 72,691,619 (GRCm39) missense probably damaging 1.00
R8494:Ankar UTSW 1 72,697,953 (GRCm39) missense probably benign 0.16
R8851:Ankar UTSW 1 72,691,535 (GRCm39) missense probably damaging 1.00
R8970:Ankar UTSW 1 72,691,496 (GRCm39) critical splice donor site probably null
R9228:Ankar UTSW 1 72,713,210 (GRCm39) missense probably benign 0.27
R9511:Ankar UTSW 1 72,719,161 (GRCm39) missense probably benign 0.23
R9577:Ankar UTSW 1 72,721,067 (GRCm39) missense probably benign 0.02
R9612:Ankar UTSW 1 72,704,294 (GRCm39) missense possibly damaging 0.65
R9647:Ankar UTSW 1 72,689,307 (GRCm39) missense probably damaging 1.00
R9803:Ankar UTSW 1 72,698,340 (GRCm39) missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72,729,120 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCATGCAACGCACTAACTAAGGAAGA -3'
(R):5'- GAATTGTCCATGCTTATTCATTCTGCCC -3'

Sequencing Primer
(F):5'- GGAAGCTATTCTATGAATACACAGTG -3'
(R):5'- GCTAGCCACATTACCTTAAGATGGT -3'
Posted On 2013-07-30