Mutagenetix > Incidental Mutations

Incidental Mutation 'R0650:Atg16l1'

62179

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

038835-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0650 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87781699 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 403 (D403V)

Ref Sequence

ENSEMBL: ENSMUSP00000108815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190]

AlphaFold

Q8C0J2

Predicted Effect

probably benign
Transcript: ENSMUST00000027512
AA Change: D387V

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: D387V

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113186
AA Change: D368V

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: D368V

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113190
AA Change: D403V

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: D403V

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158656

Meta Mutation Damage Score

0.9661

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Chd8	T	C	14: 52,202,304	E964G	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lamc2	T	A	1: 153,143,876	I440F	possibly damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Lrrk1	G	A	7: 66,292,336	A718V	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pik3c2a	A	G	7: 116,346,247		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr5	T	C	15: 38,030,807		probably benign	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0655:Atg16l1	UTSW	1	87766829	missense	probably damaging	1.00
R1421:Atg16l1	UTSW	1	87786358	splice site	probably benign
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R4990:Atg16l1	UTSW	1	87789369	missense	probably benign	0.00
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R5897:Atg16l1	UTSW	1	87785997	critical splice donor site	probably null
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	splice site	probably null
R7423:Atg16l1	UTSW	1	87786301	missense	probably damaging	1.00
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89
R8493:Atg16l1	UTSW	1	87778982	missense	probably damaging	1.00
R8742:Atg16l1	UTSW	1	87766898	missense	probably damaging	1.00
R8782:Atg16l1	UTSW	1	87786288	missense	possibly damaging	0.76
R9035:Atg16l1	UTSW	1	87765445	critical splice donor site	probably null
R9071:Atg16l1	UTSW	1	87756185	intron	probably benign
R9282:Atg16l1	UTSW	1	87780184	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GGGAAGGACTCACTCAGCTTCAAAC -3'
(R):5'- GGGCTCACATGCAAATTTCCTCAAC -3'

Sequencing Primer
(F):5'- TCAGCTTCAAACACTGGGTGAG -3'
(R):5'- AGCTTTACTACCCAAGGTCATATAC -3'

Posted On

2013-07-30