Mutagenetix > Incidental Mutation

Incidental Mutation 'R0650:Lamc2'

62180

Institutional Source

Beutler Lab

Gene Symbol

Lamc2

Ensembl Gene

ENSMUSG00000026479

Gene Name

laminin, gamma 2

Synonyms

nicein, 100kDa

MMRRC Submission

038835-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R0650 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

153122756-153186447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153143876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 440 (I440F)

Ref Sequence

ENSEMBL: ENSMUSP00000140514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027753
AA Change: I440F

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: I440F

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185356
AA Change: I440F

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: I440F

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Meta Mutation Damage Score

0.1362

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
Atg16l1	A	T	1: 87,781,699	D403V	possibly damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Chd8	T	C	14: 52,202,304	E964G	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Lrrk1	G	A	7: 66,292,336	A718V	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pik3c2a	A	G	7: 116,346,247		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr5	T	C	15: 38,030,807		probably benign	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Lamc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Lamc2	APN	1	153130056	missense	probably benign	0.00
IGL00907:Lamc2	APN	1	153144651	missense	probably benign	0.32
IGL02026:Lamc2	APN	1	153144736	splice site	probably benign
IGL02335:Lamc2	APN	1	153166216	missense	probably benign	0.00
IGL02568:Lamc2	APN	1	153166262	missense	possibly damaging	0.91
IGL02640:Lamc2	APN	1	153152057	missense	probably damaging	0.99
IGL02801:Lamc2	APN	1	153136783	missense	probably benign	0.10
IGL02827:Lamc2	APN	1	153139781	missense	probably damaging	1.00
IGL03240:Lamc2	APN	1	153124125	missense	probably damaging	1.00
IGL03245:Lamc2	APN	1	153133757	splice site	probably null
abasement	UTSW	1	153127025	missense	probably null	0.86
ANU74:Lamc2	UTSW	1	153131835	missense	probably benign	0.00
R0279:Lamc2	UTSW	1	153130696	missense	probably benign	0.01
R0528:Lamc2	UTSW	1	153124094	missense	probably damaging	1.00
R0597:Lamc2	UTSW	1	153133621	missense	probably benign	0.02
R0826:Lamc2	UTSW	1	153152082	missense	probably damaging	1.00
R1015:Lamc2	UTSW	1	153166199	missense	possibly damaging	0.53
R1172:Lamc2	UTSW	1	153166287	missense	probably damaging	1.00
R1308:Lamc2	UTSW	1	153150818	missense	probably damaging	1.00
R1521:Lamc2	UTSW	1	153166263	missense	probably benign	0.11
R1525:Lamc2	UTSW	1	153130756	missense	probably benign	0.00
R1602:Lamc2	UTSW	1	153127028	missense	probably benign	0.00
R1631:Lamc2	UTSW	1	153158934	missense	possibly damaging	0.95
R1633:Lamc2	UTSW	1	153141698	nonsense	probably null
R1832:Lamc2	UTSW	1	153166187	missense	possibly damaging	0.72
R1978:Lamc2	UTSW	1	153133597	critical splice donor site	probably null
R1996:Lamc2	UTSW	1	153154470	missense	possibly damaging	0.84
R2046:Lamc2	UTSW	1	153141765	missense	probably benign	0.01
R2107:Lamc2	UTSW	1	153154386	splice site	probably benign
R2130:Lamc2	UTSW	1	153127124	missense	probably damaging	1.00
R2182:Lamc2	UTSW	1	153126866	missense	possibly damaging	0.46
R2207:Lamc2	UTSW	1	153133706	missense	possibly damaging	0.68
R2218:Lamc2	UTSW	1	153130779	missense	probably benign	0.21
R3772:Lamc2	UTSW	1	153124251	missense	probably benign
R4616:Lamc2	UTSW	1	153166169	missense	probably damaging	1.00
R4874:Lamc2	UTSW	1	153154395	missense	probably null	1.00
R4939:Lamc2	UTSW	1	153126836	missense	probably damaging	1.00
R4985:Lamc2	UTSW	1	153136805	missense	probably benign
R5544:Lamc2	UTSW	1	153124053	missense	possibly damaging	0.93
R5632:Lamc2	UTSW	1	153131890	missense	probably damaging	1.00
R5771:Lamc2	UTSW	1	153141594	missense	probably benign	0.04
R5811:Lamc2	UTSW	1	153166253	missense	possibly damaging	0.53
R6058:Lamc2	UTSW	1	153136829	missense	probably benign	0.01
R6130:Lamc2	UTSW	1	153136777	missense	probably benign	0.01
R6137:Lamc2	UTSW	1	153166153	missense	possibly damaging	0.90
R6994:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6995:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6997:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R7000:Lamc2	UTSW	1	153166127	missense	possibly damaging	0.72
R7018:Lamc2	UTSW	1	153136742	missense	probably benign	0.00
R7145:Lamc2	UTSW	1	153130772	missense	possibly damaging	0.95
R7148:Lamc2	UTSW	1	153185984	missense	probably benign	0.01
R7171:Lamc2	UTSW	1	153139749	missense	probably damaging	1.00
R7640:Lamc2	UTSW	1	153136804	missense	possibly damaging	0.79
R7673:Lamc2	UTSW	1	153124036	missense	probably damaging	1.00
R7684:Lamc2	UTSW	1	153127025	missense	probably null	0.86
R7712:Lamc2	UTSW	1	153133611	missense	possibly damaging	0.81
R7940:Lamc2	UTSW	1	153130775	nonsense	probably null
R8153:Lamc2	UTSW	1	153124104	frame shift	probably null
R8211:Lamc2	UTSW	1	153166278	missense	probably damaging	1.00
R8486:Lamc2	UTSW	1	153158891	missense	probably benign
R8739:Lamc2	UTSW	1	153144653	nonsense	probably null
R8744:Lamc2	UTSW	1	153143738	missense	probably benign	0.19
R8911:Lamc2	UTSW	1	153152127	missense	probably damaging	1.00
R9435:Lamc2	UTSW	1	153137326	missense	probably benign	0.00
R9457:Lamc2	UTSW	1	153139854	missense	probably benign
RF024:Lamc2	UTSW	1	153152055	missense	possibly damaging	0.70
Z1176:Lamc2	UTSW	1	153133621	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CCCAGAAATTCTCCTGAATGGGAGC -3'
(R):5'- TGACCAAACGGTGTGACCATGAAG -3'

Sequencing Primer
(F):5'- CCTGAATGGGAGCTATTTGCAC -3'
(R):5'- ACAGTGCTATTCTACGGCCAG -3'

Posted On

2013-07-30