Incidental Mutation 'R0650:Kcna4'
ID 62184
Institutional Source Beutler Lab
Gene Symbol Kcna4
Ensembl Gene ENSMUSG00000042604
Gene Name potassium voltage-gated channel, shaker-related subfamily, member 4
Synonyms Kv1.4
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0650 (G1)
Quality Score 167
Status Validated
Chromosome 2
Chromosomal Location 107290639-107298502 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 107295582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 220 (Y220*)
Ref Sequence ENSEMBL: ENSMUSP00000037958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037012]
AlphaFold Q61423
Predicted Effect probably null
Transcript: ENSMUST00000037012
AA Change: Y220*
SMART Domains Protein: ENSMUSP00000037958
Gene: ENSMUSG00000042604
AA Change: Y220*

DomainStartEndE-ValueType
Pfam:K_channel_TID 1 74 1.5e-42 PFAM
low complexity region 77 89 N/A INTRINSIC
coiled coil region 112 139 N/A INTRINSIC
low complexity region 160 166 N/A INTRINSIC
BTB 177 277 1.67e-8 SMART
Pfam:Ion_trans 307 572 2.8e-51 PFAM
Pfam:Ion_trans_2 480 565 9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173191
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal; however, a small subset of mutants exhibit spontaneous seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Kcna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kcna4 APN 2 107295862 missense probably damaging 1.00
IGL01025:Kcna4 APN 2 107296391 missense probably damaging 0.99
IGL01433:Kcna4 APN 2 107296733 missense probably damaging 0.99
IGL01805:Kcna4 APN 2 107296498 missense probably damaging 1.00
IGL02121:Kcna4 APN 2 107296618 missense possibly damaging 0.92
Pinched UTSW 2 107296549 missense probably damaging 1.00
R6381_Kcna4_300 UTSW 2 107294972 missense probably benign 0.05
PIT4377001:Kcna4 UTSW 2 107296860 missense possibly damaging 0.83
R0255:Kcna4 UTSW 2 107296562 missense probably damaging 1.00
R0761:Kcna4 UTSW 2 107296072 missense probably benign 0.02
R1211:Kcna4 UTSW 2 107295315 small deletion probably benign
R1553:Kcna4 UTSW 2 107296687 missense probably benign 0.02
R1854:Kcna4 UTSW 2 107296484 missense probably damaging 1.00
R1915:Kcna4 UTSW 2 107296778 missense probably benign 0.01
R1974:Kcna4 UTSW 2 107296220 missense possibly damaging 0.65
R4002:Kcna4 UTSW 2 107295914 missense probably damaging 1.00
R4163:Kcna4 UTSW 2 107295806 missense probably damaging 1.00
R4413:Kcna4 UTSW 2 107295373 missense probably benign 0.01
R4474:Kcna4 UTSW 2 107296007 missense probably benign
R4492:Kcna4 UTSW 2 107296091 missense probably damaging 1.00
R4525:Kcna4 UTSW 2 107295065 missense possibly damaging 0.93
R4766:Kcna4 UTSW 2 107296543 missense probably damaging 1.00
R4787:Kcna4 UTSW 2 107296468 missense probably damaging 1.00
R5423:Kcna4 UTSW 2 107295806 nonsense probably null
R5725:Kcna4 UTSW 2 107296876 missense possibly damaging 0.48
R6381:Kcna4 UTSW 2 107294972 missense probably benign 0.05
R6399:Kcna4 UTSW 2 107296549 missense probably damaging 1.00
R6787:Kcna4 UTSW 2 107295325 missense possibly damaging 0.91
R6891:Kcna4 UTSW 2 107296307 missense probably damaging 1.00
R7057:Kcna4 UTSW 2 107295320 missense probably damaging 0.96
R7250:Kcna4 UTSW 2 107296318 missense possibly damaging 0.92
R7522:Kcna4 UTSW 2 107296255 missense probably damaging 1.00
R7799:Kcna4 UTSW 2 107295892 missense possibly damaging 0.70
R8758:Kcna4 UTSW 2 107296149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCGTACACAGACCTGCTGC -3'
(R):5'- AAGGTCCCTATCATCCCTGAACTCC -3'

Sequencing Primer
(F):5'- TGCTGCCACAGGATGATG -3'
(R):5'- TGAACTCCGGCAAGGTTTC -3'
Posted On 2013-07-30